Glyma15g40990 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g40990

Feature Type:	gene_model
Chromosome:	Gm15
Start:	47989677
stop:	47990821
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g40990

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G31730	AT	Annotation by Michelle Graham. TAIR10: glutamine dumper 1 \| chr4:15361207-15361683 FORWARD LENGTH=158	SoyBase	E_val: 8.00E-18	ISS
GO:0010585	GO-bp	Annotation by Michelle Graham. GO Biological Process: glutamine secretion	SoyBase	N/A	ISS
GO:0080143	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of amino acid export	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
UniRef100_I1MJ93	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MJ93_SOYBN	SoyBase	E_val: 6.00E-80	ISS
UniRef100_O81775	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein GLUTAMINE DUMPER 1 n=1 Tax=Arabidopsis thaliana RepID=GDU1_ARATH	SoyBase	E_val: 4.00E-15	ISS

Expression Patterns of Glyma15g40990

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g40990 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma15g40990

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g40990

Limit To All Plant Sequences

>Glyma15g40990.1   sequence type=CDS   gene model=Glyma15g40990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTTCTCGACACTCCTCGACATGGCACTCTGGTTCTGTACCTGTTTGGAAGACTGGCTACAATGCTCGATCTTATAGCCTTTGCGCTTTTGATCTTAGCCTGCTCCTACTGGAAACTTTCTGGTCAGTTACTGAACGAAGAAAACACTGAAAGGGACTTGGAAAATGTTGTTAGTGGTGAGAAACAGGGTGACTTCGCAAACAAGGAATCAATTAAGGTGTACAAGGAGAAGATTCTCGTCATTATGGCTGGAGATGACCCCAATGTACCAAGAAATAGTTCAATTTATCATAGGCCCATTTACATCATAAGTCCATATAACAAATACTCATCATTAATTATAAGAAATATTATTTAA

Predicted protein sequences of Glyma15g40990

Limit To All Plant Sequences

>Glyma15g40990.1   sequence type=predicted peptide   gene model=Glyma15g40990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LLDTPRHGTLVLYLFGRLATMLDLIAFALLILACSYWKLSGQLLNEENTERDLENVVSGEKQGDFANKESIKVYKEKILVIMAGDDPNVPRNSSIYHRPIYIISPYNKYSSLIIRNII*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain