SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma15g40581

Feature Type:gene_model
Chromosome:Gm15
Start:47575272
stop:47581418
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G79070AT Annotation by Michelle Graham. TAIR10: SNARE-associated protein-related | chr1:29745018-29745807 REVERSE LENGTH=138 SoyBaseE_val: 3.00E-35ISS
GO:0006661GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylinositol biosynthetic process SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_I1KU57UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KU57_SOYBN SoyBaseE_val: 1.00E-88ISS
UniRef100_O64544UniRef Annotation by Michelle Graham. Most informative UniRef hit: YUP8H12R.31 n=1 Tax=Arabidopsis thaliana RepID=O64544_ARATH SoyBaseE_val: 3.00E-33ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g40581 not represented in the dataset

Glyma15g40581 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g18430 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g40581.1   sequence type=CDS   gene model=Glyma15g40581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACGATTTTTCTCAGTCACAGCATCACTTCCTTCTGCGCACCGAACTGAACCAAACGACAATGGAAGCAGCGGAAAACGACAGCGTCGTACTCGAAACGACGGAGCCTTCCAGTTCCCACGGTTCCGACGGCGACGATCACCTCCGACAGAGCTCCGACGTGCTGGCCAAAGGCTTGTCTTCGATGCTCTCTTCGGTGATTAGCGATTTCGATTTCAGAGCTCAGCAAACTCTCCAAAGCCAGAACCACCTCTCTTCCGTCATCGATCGTCTCACCGGAGAACTTGATCAGTTACTTGAAGATGCACCTTTACCATTCATAATGCAGCAAGCTGCCAAGATTTCTAGTGTTAGGAAAAGAGTTTCATCACTGAATTTACTTCTAAAATCCATACAAGGGCGGATTGATAATATAGATCGCATGCTATCTATTGGCCCCACTCATGGTAGCCCAGAAGCATCACGGCTGCTCTGGCTTGATAAGGAAAGTGGTCAGCATGCATTATCAGCTTCTAGGGCCACTGAAGATGTTGACAACCCTATTAGTTATGATATCTACGATATGATTCTGACAAGAACCATAGGACTTGAGATGACCGGAAGGTCGAGTATGCATAAGATATTTTGTAACAAGCAGAAATATCCCATAGGCAACCTGTCATATATATCCCATTCCCTGCGTTTAGGAAATGAAAAAGAAAAGAGGAAAACAGCTGATTTACCTCGCAAGATAAAAGTGATTGCACGCATCCTCATCTCCATAAAAAGCTAA

>Glyma15g40581.1   sequence type=predicted peptide   gene model=Glyma15g40581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNDFSQSQHHFLLRTELNQTTMEAAENDSVVLETTEPSSSHGSDGDDHLRQSSDVLAKGLSSMLSSVISDFDFRAQQTLQSQNHLSSVIDRLTGELDQLLEDAPLPFIMQQAAKISSVRKRVSSLNLLLKSIQGRIDNIDRMLSIGPTHGSPEASRLLWLDKESGQHALSASRATEDVDNPISYDIYDMILTRTIGLEMTGRSSMHKIFCNKQKYPIGNLSYISHSLRLGNEKEKRKTADLPRKIKVIARILISIKS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo