SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g39908): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g39908): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g39908

Feature Type:gene_model
Chromosome:Gm15
Start:46815514
stop:46821690
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g39908
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G46210AT Annotation by Michelle Graham. TAIR10: cullin4 | chr5:18731569-18736653 REVERSE LENGTH=792 SoyBaseE_val: 2.00E-50ISS
GO:0000209GO-bp Annotation by Michelle Graham. GO Biological Process: protein polyubiquitination SoyBaseN/AISS
GO:0006281GO-bp Annotation by Michelle Graham. GO Biological Process: DNA repair SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0007049GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009755GO-bp Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010100GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of photomorphogenesis SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048367GO-bp Annotation by Michelle Graham. GO Biological Process: shoot development SoyBaseN/AISS
GO:0048575GO-bp Annotation by Michelle Graham. GO Biological Process: short-day photoperiodism, flowering SoyBaseN/AISS
GO:0048608GO-bp Annotation by Michelle Graham. GO Biological Process: reproductive structure development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0000151GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ubiquitin ligase complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0031461GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cullin-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0080008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
PTHR11932Panther CULLIN JGI ISS
PTHR11932:SF53Panther SUBFAMILY NOT NAMED JGI ISS
PF00888PFAM Cullin family JGI ISS
UniRef100_B9S106UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cullin, putative n=1 Tax=Ricinus communis RepID=B9S106_RICCO SoyBaseE_val: 2.00E-64ISS
UniRef100_I1M1G1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Papilionoideae RepID=I1M1G1_SOYBN SoyBaseE_val: 6.00E-66ISS

Expression Patterns of Glyma15g39908
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g39908 not represented in the dataset
Glyma15g39908 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g39908 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g249700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g39908
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Transcripts of Glyma15g39908
>Glyma15g39908.2   sequence type=transcript   gene model=Glyma15g39908   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GACAGAAGCTCTTTTTGCTGACCTAGCCCATTTTCCGATTCAACTAACCCTTCAAAATAGGCTTTCTCTCTCTCCGATTCGCCAATATCTCTTCCTTTGCTTAATTCCTGCTACTTAAAAATTAGGTTTTAGCACTTTAATTATTGCTTTTGATCTGTGATTAATTGTTCCCGAACTGCCTTGCACGATTCTTCATCTAAGTTTCTTTTCTGCGTCGAATTGAACTTCCTTTTTCTTTGCTCTAGCTAGTTATTTGTTATTTCTGGACTCTTGTGTGCCTAATATTAGTAACCTAAGTGAGTCTGAGCTAAAGGTAGTTCCTATTGTAAGATTATTATGGCTTTGTTTGGATGAGCTTCTCAATGAACACTTATAGGAGAAGAAAATAGGAAGATAACATGGATTGAACCTTTTTCTATTAGCTAAAATTAAGTTATGCACTTCAGCTTTTGGAGAAGTTAGATAAGGGAGCTTTTATAAGTTCTGTATGTGTCTTGTATTTTCCTCCCAGGGAAATTCTGTTTTATAGATGCTACTGAGTGAGTCTTGTGAACCTTACTGTTCTGGAGAGCTCTGTTATTATGAGGAATGATGATAATCTGGTTCGAGCTATCAGATGTTGATGTATCTATTGTCTGTCTTTTTCTGATATGTTGTTGTCCTTGTGGTTTTGAGCTTATTTTTTGTTGAAATGATTCATGATAGCATATTGACATTTCCAAGATAATGATTATAGGTTCGGTTTCAAACTTACCATTACGTTAACCTCTTGTATGATGTTATTTAATTTTGAGATATCTTTTATCACCTCCCTCACTAGATTCTATGTCTGAAACTTTAAGTGTCTCATGATTGTCTTATTATTATGTCGAATGTGCCTTTTAAACATGGCTGTACTGCAAGTTTGTTTTCCTTATTTTGCATATATTTCTAGCTTCATTCTCTTTTGTTGAAAATCCATTCACATGGAAGTTTATATAAATAATATCTAATTTTTAGCTTCTGAATAGGATGACTTTTAAATATCTTTTTTCATACTTTTCTGTTTTCCTTTTGTAGCTAAACCAACATTGCCCACAAATTTCGAGGAGGATACATGGGCAAAACTAAAGTCTGCCATTTGTGCTATATTTTTGAAGCAACCTAACTCTTGTGACTTGGAGAAGCTTTATCAGGCTGTGAACGATCTCTGCCTATATAAAATGGGTGTAAATCTTCATCAACAGATTGAAAAGGAGTGTGAAGCACATATATCTGCTGCACTGCAGTCTTTGGTTGGCCAAAGCCCAGATTTGGTTGTTTTTCGGTCTCTAGTTGAGAGATGTTGGCAGGATCTTTGTGACCAAATGTTGATGATTCGTGGTATAGCCTTGTATCTAGATAGGACATATGTGAAGCAAACAGCAAATGTTCGATCATTATGGGACATGGGCTTACAACTTTTCCGCAAACATCTTTCATTGTCTCCTGAAGTAGAACACAAAACTGTTACTGGTCTTCTACGAATGATTGAAAGTGAAAGGAAATCAAATGCAATTGTCAAAGGCAAAAGAGTGTCAAATACCGTTGTATGACTCTAGTTGTGCTTATGAAGGTACTCCTTGTATCATGGATTGCGAATTCTTTTATCGTGGGAAGGGAATATGCATTTCTAACATGAAATGCATTTGTCATTACAAATGTTAAACTATTGTTTATGACAACCACTCACCTTTTGGTGAATGTGTGGAATGTAAAAAAATAAAACAAAAGAATAAATTGGTTACATTATTCCAG
Coding sequences of Glyma15g39908
>Glyma15g39908.1   sequence type=CDS   gene model=Glyma15g39908   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGTAAATCTTCATCAACAGATTGAAAAGGAGTGTGAAGCACATATATCTGCTGCACTGCAGTCTTTGGTTGGCCAAAGCCCAGATTTGGTTGTTTTTCGGTCTCTAGTTGAGAGATGTTGGCAGGATCTTTGTGACCAAATGTTGATGATTCGTGGTATAGCCTTGTATCTAGATAGGACATATGTGAAGCAAACAGCAAATGTTCGATCATTATGGGACATGGGCTTACAACTTTTCCGCAAACATCTTTCATTGTCTCCTGAAGTAGAACACAAAACTGTTACTGGTCTTCTACGAATGATTGAAAGTGAAAGGAAATCAAATGCAATTGTCAAAGGCAAAAGAGTGTCAAATACCGTTGTATGA

>Glyma15g39908.2   sequence type=CDS   gene model=Glyma15g39908   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGTAAATCTTCATCAACAGATTGAAAAGGAGTGTGAAGCACATATATCTGCTGCACTGCAGTCTTTGGTTGGCCAAAGCCCAGATTTGGTTGTTTTTCGGTCTCTAGTTGAGAGATGTTGGCAGGATCTTTGTGACCAAATGTTGATGATTCGTGGTATAGCCTTGTATCTAGATAGGACATATGTGAAGCAAACAGCAAATGTTCGATCATTATGGGACATGGGCTTACAACTTTTCCGCAAACATCTTTCATTGTCTCCTGAAGTAGAACACAAAACTGTTACTGGTCTTCTACGAATGATTGAAAGTGAAAGGAAATCAAATGCAATTGTCAAAGGCAAAAGAGTGTCAAATACCGTTGTATGA
Predicted protein sequences of Glyma15g39908
>Glyma15g39908.1   sequence type=predicted peptide   gene model=Glyma15g39908   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVNLHQQIEKECEAHISAALQSLVGQSPDLVVFRSLVERCWQDLCDQMLMIRGIALYLDRTYVKQTANVRSLWDMGLQLFRKHLSLSPEVEHKTVTGLLRMIESERKSNAIVKGKRVSNTVV*

>Glyma15g39908.2   sequence type=predicted peptide   gene model=Glyma15g39908   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVNLHQQIEKECEAHISAALQSLVGQSPDLVVFRSLVERCWQDLCDQMLMIRGIALYLDRTYVKQTANVRSLWDMGLQLFRKHLSLSPEVEHKTVTGLLRMIESERKSNAIVKGKRVSNTVV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo