Glyma15g39845 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g39845

Feature Type:	gene_model
Chromosome:	Gm15
Start:	46744056
stop:	46744728
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g39845

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G68600	AT	Annotation by Michelle Graham. TAIR10: Aluminium activated malate transporter family protein \| chr1:25759947-25762778 FORWARD LENGTH=537	SoyBase	E_val: 1.00E-14	ISS
GO:0000023	GO-bp	Annotation by Michelle Graham. GO Biological Process: maltose metabolic process	SoyBase	N/A	ISS
GO:0010044	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to aluminum ion	SoyBase	N/A	ISS
GO:0019252	GO-bp	Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
PF11744	PFAM	Aluminium activated malate transporter	JGI		ISS
UniRef100_G7L918	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Aluminum activated malate transporter n=1 Tax=Medicago truncatula RepID=G7L918_MEDTR	SoyBase	E_val: 1.00E-14	ISS
UniRef100_I1KQ48	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KQ48_SOYBN	SoyBase	E_val: 8.00E-19	ISS

Expression Patterns of Glyma15g39845

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g39845 not represented in the dataset	Glyma15g39845 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g39845 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g249100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g39845

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g39845

Limit To All Plant Sequences

>Glyma15g39845.1   sequence type=CDS   gene model=Glyma15g39845   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATCATCTTTTATTGTTCACTTATTTTTTTTTCATATATATACACATCTAAAATATGTGCATCAATGGTCCAAATTAGTGTTATCAATCACTACCTTCATGGTGTTGAATATAAGGAGGTGCCATCTAAATTTCTTACTTACCAAGCTGCTGATGACCAAATTTACAATGGCCACAGATCAGTTGTTGAATCTACAAGTAAAGAAGATTCATTGGTACTGTCTACTATATGGCCTATATTAAGTGGGCATATATCATTTTACAATTTTGGTTAA

Predicted protein sequences of Glyma15g39845

Limit To All Plant Sequences

>Glyma15g39845.1   sequence type=predicted peptide   gene model=Glyma15g39845   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIIFYCSLIFFSYIYTSKICASMVQISVINHYLHGVEYKEVPSKFLTYQAADDQIYNGHRSVVESTSKEDSLVLSTIWPILSGHISFYNFG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain