SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g39197): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g39197): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g39197

Feature Type:gene_model
Chromosome:Gm15
Start:45800684
stop:45803028
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g39197
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G10070AT Annotation by Michelle Graham. TAIR10: KH domain-containing protein | chr4:6295608-6299759 REVERSE LENGTH=725 SoyBaseE_val: 3.00E-22ISS
GO:0000956GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear-transcribed mRNA catabolic process SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009688GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
PTHR10288Panther RNA-BINDING PROTEIN RELATED JGI ISS
PTHR10288:SF53Panther KH DOMAIN-CONTAINING PROTEIN JGI ISS
PF00013PFAM KH domain JGI ISS
UniRef100_G7K7W5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Far upstream element-binding protein n=1 Tax=Medicago truncatula RepID=G7K7W5_MEDTR SoyBaseE_val: 1.00E-30ISS
UniRef100_I1MIY6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MIY6_SOYBN SoyBaseE_val: 9.00E-48ISS

Expression Patterns of Glyma15g39197
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g39197 not represented in the dataset
Glyma15g39197 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g39197 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g244500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g39197
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g39197
>Glyma15g39197.1   sequence type=CDS   gene model=Glyma15g39197   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAAGAAGCAGAACGACATCCAGAAAACGGGGCTAGGTCGAGCCCTGCTATCTCGCTTCTACAGGAAGAAGTTCCTTGAATCCTTCAACGAAGTCTCCGACATCGACGCCGTTGTCGAGCAATCCCTAGAACCCCTCCCCAAACTCGTCGCTGCCGCTTCAACCACTCTTATCAGCCTCGAACCAGGTTCCGTCCCTGATGAAACGACGACCCCAGAAGAAGCGAGGAAGCAGCAGAAGCAAGAGGAGATTGAACACTACCTTGTTGGTGTACTTATTGGCAAGGCTGGAGATACTATACGATACCTGCAGTATAATTCAGGCGCAAAGATTCAGATCACAAGGGATGCTGATGCTGATCCTCTCTGTGCAACAAGGTCTGTGGAATTGATAGGAATTTTGGAAAGTATTGATAAGGCAGAAAAACTAATGAATGTTGTGATTGCAGAGGCTGATGCTGGGGTTCTCCTTCACTTGTAG
Predicted protein sequences of Glyma15g39197
>Glyma15g39197.1   sequence type=predicted peptide   gene model=Glyma15g39197   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKKQNDIQKTGLGRALLSRFYRKKFLESFNEVSDIDAVVEQSLEPLPKLVAAASTTLISLEPGSVPDETTTPEEARKQQKQEEIEHYLVGVLIGKAGDTIRYLQYNSGAKIQITRDADADPLCATRSVELIGILESIDKAEKLMNVVIAEADAGVLLHL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo