SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 156 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g38936): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g38936): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g38936

Feature Type:gene_model
Chromosome:Gm15
Start:45431543
stop:45433571
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G32860AT Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase superfamily protein | chr1:11907308-11908803 REVERSE LENGTH=426 SoyBaseE_val: 4.00E-31ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0046658GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0043169GO-mf Annotation by Michelle Graham. GO Molecular Function: cation binding SoyBaseN/AISS
PF00332PFAM Glycosyl hydrolases family 17 JGI ISS
UniRef100_E9N6T7UniRef Annotation by Michelle Graham. Most informative UniRef hit: 1,3-beta-D-glucanase GH17_33 n=1 Tax=Populus tremula x Populus tremuloides RepID=E9N6T7_9ROSI SoyBaseE_val: 3.00E-32ISS
UniRef100_I1MIW8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MIW8_SOYBN SoyBaseE_val: 2.00E-143ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g38936 not represented in the dataset

Glyma15g38936 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g38936.1   sequence type=CDS   gene model=Glyma15g38936   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATTCTACAACCAGGTTTTACGATAGTTCTAACAAAACGGATGTTACCCCCACAGAGGTGTCAGTGAAGGTCAATAAGTACACTCGTTCTAGTGCACCAACACTTTCACCCTCACTCCTCATTTTCGAGCGAGGATTTGTAGAAGTTGCAACTGATATCGGGTGTGAAAGATTTTCGAGCGAGCAACAAGGGCTTATTATTAAGTGGAAAAAAAGAGGTTCAATTAGCCTCATCGCGCGCTGTTGGAAGCCATTTGGGCACGGTGACGACGCCGATAATGCTACCATTGTCGGAAGAGAATGCAAGGACGACCTCCTCTGGTACTACGACATCGAAAAGTTCGCCGCCAACTATTTCTCCATGGTCCTCGAGGACCAGAGCCAGATCGAGTCCGACGGCTTCGGCAACTTTGTCGACGTGTACGACGGCCAGGGGATGGTGGACCCGAAGCAGGTTCCGTTGGACCACGTTCTCTTCCAACCCAACAAGGGGATGGTGGACCCCTCCAGTAACCTCCACTATGATAACATGCTTTTCACGCAGATCGATGCGGTGTATTCCGCGTTGGACTCCTTGGCCTACAGGAAGTTGCCAGTTCACATTTCAGAAACCAGTTCGCCTTCCAAAGGGGATCTGGACGAAACCAGTGTGAACCTCGAGAACGCCAAGAACTATAACGGGAATCTTATTAAGATCTCTCTCTCTCTCCCCCCTTTCAGGCATTACTTGGTTGTTCCTGTGGTGCACATTCCTACTGTTAAATATCTTCAGAGGAAAACTGACGACTATTATTTGGTGAGTCACATGTTAAAGGTGGGGAAGATGTTATTAAATAGAGATGCACCTCAGTCCCAGCATTGGGCAGAGTCATGTTTGTTTCATGCATATTTGGAATAA

>Glyma15g38936.1   sequence type=predicted peptide   gene model=Glyma15g38936   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHSTTRFYDSSNKTDVTPTEVSVKVNKYTRSSAPTLSPSLLIFERGFVEVATDIGCERFSSEQQGLIIKWKKRGSISLIARCWKPFGHGDDADNATIVGRECKDDLLWYYDIEKFAANYFSMVLEDQSQIESDGFGNFVDVYDGQGMVDPKQVPLDHVLFQPNKGMVDPSSNLHYDNMLFTQIDAVYSALDSLAYRKLPVHISETSSPSKGDLDETSVNLENAKNYNGNLIKISLSLPPFRHYLVVPVVHIPTVKYLQRKTDDYYLVSHMLKVGKMLLNRDAPQSQHWAESCLFHAYLE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo