|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G59190 | AT | Annotation by Michelle Graham. TAIR10: F-box/RNI-like superfamily protein | chr3:21884740-21886101 FORWARD LENGTH=388 | SoyBase | E_val: 2.00E-14 | ISS |
| GO:0008150 | GO-bp | Annotation by Michelle Graham. GO Biological Process: biological process | SoyBase | N/A | ISS |
| GO:0010093 | GO-bp | Annotation by Michelle Graham. GO Biological Process: specification of floral organ identity | SoyBase | N/A | ISS |
| GO:0048440 | GO-bp | Annotation by Michelle Graham. GO Biological Process: carpel development | SoyBase | N/A | ISS |
| GO:0048507 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meristem development | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| UniRef100_G7IJK8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: F-box/LRR-repeat protein n=1 Tax=Medicago truncatula RepID=G7IJK8_MEDTR | SoyBase | E_val: 1.00E-16 | ISS |
| UniRef100_UPI000233BCCA | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233BCCA related cluster n=1 Tax=unknown RepID=UPI000233BCCA | SoyBase | E_val: 3.00E-79 | ISS |
|
Glyma15g38920 not represented in the dataset |
Glyma15g38920 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.15g242000 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma15g38920.1 sequence type=CDS gene model=Glyma15g38920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high AAACAACTCAAGTATGGAGCAATAAACATAATAAGCCAAATACATGACAGCATTCTTGGTCACATCTTGTCTTTCCTTCCAACTATGGAGGCAGTCCAAACTAGTGTGTTATCAACGAGGTGGATCAATGTTTGGACATCCATCACCAATCTAAAATTGAATGATCGTGTACTAAAGAAGATGCAAAAGAAACAATATGAGCATTTGGTGAACACAATGCTTCTTCACCTTGCCAATTTAAGCATCCAAAGTTTCTCTCTTTGTTTAACATGTTTTCATTATGAGTCATCCCAAGTCAGTGCATGGATCTCCTCTATATTGGAAATGGGAGTCCAAAGGCTTGAAATTCAGTATGAA
>Glyma15g38920.1 sequence type=predicted peptide gene model=Glyma15g38920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high KQLKYGAINIISQIHDSILGHILSFLPTMEAVQTSVLSTRWINVWTSITNLKLNDRVLKKMQKKQYEHLVNTMLLHLANLSIQSFSLCLTCFHYESSQVSAWISSILEMGVQRLEIQYE
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||