Glyma15g36720 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g36720

Feature Type:	gene_model
Chromosome:	Gm15
Start:	42215864
stop:	42216783
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g36720

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G07010	AT	Annotation by Michelle Graham. TAIR10: sulfotransferase 2A \| chr5:2174960-2176039 REVERSE LENGTH=359	SoyBase	E_val: 7.00E-69	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009694	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid metabolic process	SoyBase	N/A	ISS
GO:0009695	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0008146	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sulfotransferase activity	SoyBase	N/A	ISS
GO:0080131	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydroxyjasmonate sulfotransferase activity	SoyBase	N/A	ISS
KOG1584	KOG	Sulfotransferase	JGI		ISS
PTHR11783	Panther	SULFOTRANSFERASE (SULT)	JGI		ISS
PTHR11783:SF1	Panther	SULFOTRANSFERASE-RELATED	JGI		ISS
PF00685	PFAM	Sulfotransferase domain	JGI		ISS
UniRef100_G7IVU2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Sulfotransferase n=1 Tax=Medicago truncatula RepID=G7IVU2_MEDTR	SoyBase	E_val: 4.00E-90	ISS
UniRef100_UPI000233B9EC	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B9EC related cluster n=1 Tax=unknown RepID=UPI000233B9EC	SoyBase	E_val: 3.00E-153	ISS

Expression Patterns of Glyma15g36720

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g36720

Paralog	Evidence	Comments
Glyma13g26080	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g36720 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g229100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g36720

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g36720

Limit To All Plant Sequences

>Glyma15g36720.2   sequence type=CDS   gene model=Glyma15g36720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGAGCAAGAAAAGGGTTGGATAACACCTTATCTCTATTTATACCAAGGCTTTTGCGTTCCAAAATCGGGTACCACTTGGTTGAAAGCCCTTACCTTTGCTATCGTCCATCGCCAACATTTTCCATCCTTAGAGAACTACCCATTACTTGTTTTCAATCCCCATGAACGTGTGCCTCCATTTGAATTTGTCATTTATGATGATATTAATGACCAAACTCATGACTTATCCAAAATCCCAGAGCCAAGAATTTTTGGTACTCATGTTCCATTCACTTCATTGGCCAAATCAATTAAAGAGTCTAATTGTAAGATAATTTATATTTGTAGGAACCTATTTGACACCTTTGTTTCTACTTGGGTTTTTGTCAACAAAATTATGCCAAAAGATCTTGATAAGCCAAACAAGGTTATGTTCTTGAAGTATGAGGACCTTAAAGAAGATGTTAATTTTAATGTGAAGAAAATAGCAGAGTTTTTGGATTGTCCTTTCACTAAAGAGGAGGAAAGTAGTGGAGTGATTGAAAATATAATCAAGTTGTGTAGCTTTGAGAAAATGAAGGAATTAAAGGTAAACAAATCAAGAACAATGGGCAAAGGCACGATTGTTGAGAATAAGTACTTCTTTTGGAAGGCAAAAATAGGGGATTGGGTAAATTATTTGTCCCCTTCAATGGTTGAAAAGTTATCCTAA

Predicted protein sequences of Glyma15g36720

Limit To All Plant Sequences

>Glyma15g36720.2   sequence type=predicted peptide   gene model=Glyma15g36720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDEQEKGWITPYLYLYQGFCVPKSGTTWLKALTFAIVHRQHFPSLENYPLLVFNPHERVPPFEFVIYDDINDQTHDLSKIPEPRIFGTHVPFTSLAKSIKESNCKIIYICRNLFDTFVSTWVFVNKIMPKDLDKPNKVMFLKYEDLKEDVNFNVKKIAEFLDCPFTKEEESSGVIENIIKLCSFEKMKELKVNKSRTMGKGTIVENKYFFWKAKIGDWVNYLSPSMVEKLS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain