SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g35760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g35760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g35760

Feature Type:gene_model
Chromosome:Gm15
Start:40475136
stop:40480759
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02090AT Annotation by Michelle Graham. TAIR10: Proteasome component (PCI) domain protein | chr1:387479-389568 REVERSE LENGTH=260 SoyBaseE_val: 1.00E-144ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0010387GO-bp Annotation by Michelle Graham. GO Biological Process: signalosome assembly SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0008180GO-cc Annotation by Michelle Graham. GO Cellular Compartment: signalosome SoyBaseN/AISS
GO:0004708GO-mf Annotation by Michelle Graham. GO Molecular Function: MAP kinase kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG3250 KOG COP9 signalosome, subunit CSN7 JGI ISS
PTHR15350Panther COP9 COMPLEX SUBUNIT 7A JGI ISS
PF01399PFAM PCI domain JGI ISS
UniRef100_I1MIJ4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MIJ4_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q94JU3UniRef Annotation by Michelle Graham. Most informative UniRef hit: COP9 signalosome complex subunit 7 n=1 Tax=Arabidopsis thaliana RepID=CSN7_ARATH SoyBaseE_val: 5.00E-142ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g35760 not represented in the dataset

Glyma15g35760 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g224900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g35760.1   sequence type=CDS   gene model=Glyma15g35760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACATCGAGCAGAAGCAATCGGAGCTCATCGACCACTTCGTCAAGCGAGCCTCCGCGGCCTCCGACGCCGCCGCACTCGCGTCCGTCCTCGTCGAAGCCACTTCTCACCCTTCTCTCTTCGCTTTCTCCGAGATTCTCGCTCTCCCCAATCTTCTTCAGCTTGAAGCTACTGAGAATTCTGCTTATCTTGATATGCTTCGGTTGTTTGCACATGGAACATGGAGTGATTACAAGAGTAATGCTGACCGTCTTCCACAATTGATATCTGATCAGATCCTCAAGCTTAAGCAACTTACAGTTCTTACACTGGCTGAGACATACAAGGTACTACCCTATGACCAACTGATGCAGGAGTTAGATGTGACAAATGTTCGTGAGCTTGAAGATTTTCTAATTAATGAATGCATGTATGCGGGAATAGTTCGAGGAAAGTTGGATCAGTTGCGGCGATGCTTTGAGGTTCAATTTGCAGCTGGTAGGGACTTGAGGCCTGATCAACTGGGGAATATGATACAGACTCTCTCTAGCTGGTTGACTACATCAGAAAATCTGCTTGTTTCAATTCAAGAGAAGATAAAGTGGGCTGATGCTATGAGTGAAATTGACAAGAAGCACAGGAAGGAAGTGGAAGAGAAGGTAGAAGAAGTAAAGAAGTCCATTTTCAAGGCCGACATCGACTTCAGAGGCCATGAGGAGATCTGCTCTGAATCTGGTGGAGTGATGGATTATGAAGAAGATCGAAGCCGTCCAAAGAGGAGGCGGCATCCAATTTCTTGA

>Glyma15g35760.1   sequence type=predicted peptide   gene model=Glyma15g35760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDIEQKQSELIDHFVKRASAASDAAALASVLVEATSHPSLFAFSEILALPNLLQLEATENSAYLDMLRLFAHGTWSDYKSNADRLPQLISDQILKLKQLTVLTLAETYKVLPYDQLMQELDVTNVRELEDFLINECMYAGIVRGKLDQLRRCFEVQFAAGRDLRPDQLGNMIQTLSSWLTTSENLLVSIQEKIKWADAMSEIDKKHRKEVEEKVEEVKKSIFKADIDFRGHEEICSESGGVMDYEEDRSRPKRRRHPIS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo