SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g35156

Feature Type:gene_model
Chromosome:Gm15
Start:39726458
stop:39727984
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g35156
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52590AT Annotation by Michelle Graham. TAIR10: ubiquitin extension protein 1 | chr3:19505668-19506681 FORWARD LENGTH=128 SoyBaseE_val: 7.00E-38ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0003 KOG Ubiquitin/60s ribosomal protein L40 fusion JGI ISS
PTHR10666Panther UBIQUITIN JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
UniRef100_Q9AYQ8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin (Fragment) n=1 Tax=Eustoma exaltatum subsp. russellianum RepID=Q9AYQ8_EUSER SoyBaseE_val: 8.00E-37ISS
UniRef100_UPI000233B88AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B88A related cluster n=1 Tax=unknown RepID=UPI000233B88A SoyBaseE_val: 7.00E-40ISS

Expression Patterns of Glyma15g35156
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g35156 not represented in the dataset
Glyma15g35156 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g35156 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g222700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g35156
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g35156
>Glyma15g35156.1   sequence type=CDS   gene model=Glyma15g35156   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGCGTCCATGAAGGCCCAAACGTCGACACTCTCCAGAATGGATTGGAAATCCTCCGAATCCATCACCAAAACGAAAAAACAAAATCAACCTAACCAATGCCGAGCTGGCATTCCTCCGGATCAACAGCGTTTGATTTTCACCGGAAAACAACTTGAAGATGGAAGGACCCTGGCCGATTACAACATCCAAAAGGAATCAACCCTTCATCTCGTCCTCAGGCTTCGTGGTGGCATCATTGAGCCTTCCCTCATGGCTTTGGCTCGCAAATACAACCAGGACAAGATGATTTTCCACAGCATGATACTAATAAAAGTACTTTTAGTTCTAAGCTTAAGCTTATTCAAAGAGGCTCGCAATGGAGTTGGTCACAGTTTTGACCAGTCCACTATCCTTGTTAATCCACGGTTCAGAACATTATTAGATGGCTCAATTGCCTTGCTGGATTTTCTCTTCGTCACATTCGTTGAGAGTGTAATGCTGTTGCGGACAGATTGA
Predicted protein sequences of Glyma15g35156
>Glyma15g35156.1   sequence type=predicted peptide   gene model=Glyma15g35156   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAASMKAQTSTLSRMDWKSSESITKTKKQNQPNQCRAGIPPDQQRLIFTGKQLEDGRTLADYNIQKESTLHLVLRLRGGIIEPSLMALARKYNQDKMIFHSMILIKVLLVLSLSLFKEARNGVGHSFDQSTILVNPRFRTLLDGSIALLDFLFVTFVESVMLLRTD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo