SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g35130

Feature Type:gene_model
Chromosome:Gm15
Start:39672342
stop:39673419
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g35130
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G61750AT Annotation by Michelle Graham. TAIR10: RmlC-like cupins superfamily protein | chr5:24812804-24813436 REVERSE LENGTH=210 SoyBaseE_val: 3.00E-61ISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0030145GO-mf Annotation by Michelle Graham. GO Molecular Function: manganese ion binding SoyBaseN/AISS
GO:0045735GO-mf Annotation by Michelle Graham. GO Molecular Function: nutrient reservoir activity SoyBaseN/AISS
PF00190PFAM Cupin JGI ISS
UniRef100_C7S8C9UniRef Annotation by Michelle Graham. Best UniRef hit: Germin-like protein 15 n=1 Tax=Glycine max RepID=C7S8C9_SOYBN SoyBaseE_val: 5.00E-167ISS
UniRef100_C7S8C9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Germin-like protein 15 n=1 Tax=Glycine max RepID=C7S8C9_SOYBN SoyBaseE_val: 5.00E-167ISS

Expression Patterns of Glyma15g35130
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g35130
ParalogEvidenceComments
Glyma08g24320 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g35130 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g222500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g35130
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g35130
>Glyma15g35130.1   sequence type=CDS   gene model=Glyma15g35130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAACTCTTTGCTCACTTTTTCTTTATGTTGTTGTTCTTGGTGGCCTTTTCCAACATCCAAGTTTGTTTGGGGGACTGTGATAATCTTCAGGACACTTGTCCAGCAGTTCCACCCAATAAGCAGACCATATTCATCAATGGTCTTCAATGCAAAAACCCAGTTAATGTAACAGCTCAAGATTTCAGGACCACAGAACTAAGCAAAACTGGCCCTAGAGACATTTTTGGTGCATCTTTGAAAATTGTGAGTGCTGCTGAGTTCATTGGCCTCAATACTCTTGGCCTCTCCATTGGAAGAACTGACCTTGATGGGAATGGCCTGGTGAACTTCCACTATCATCCTAGGGCTACTGAGATAATCTATGTCACCAAAGGGGTGTTGTTGGCTGGTTTTGTTGACACCAAAAACCAGTATTTCCAGAAGTTTCTTAAAGTAGGTGATGTCTTTGTGTTCCCCAAGGCTTTGTTCCACTTCTTTCTAAATACTGATTTTGAAGAAGCCACTGTTTTCTCAGTGTACAACAGCCAGAATCCTGGCTTTGTGTCCCTTAGTCCTACAACTTTTGACACAACATTGGAGTCATTGGACAAGATCAAGAAGAGACTCATCTCACTCTCTGCCTCTGAAGCTCAAGCTCAAGCTCAAGATGTCAACAGTTTCATCTCTCCAGAATTGGAAACCATTTACAGTTAG
Predicted protein sequences of Glyma15g35130
>Glyma15g35130.1   sequence type=predicted peptide   gene model=Glyma15g35130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKLFAHFFFMLLFLVAFSNIQVCLGDCDNLQDTCPAVPPNKQTIFINGLQCKNPVNVTAQDFRTTELSKTGPRDIFGASLKIVSAAEFIGLNTLGLSIGRTDLDGNGLVNFHYHPRATEIIYVTKGVLLAGFVDTKNQYFQKFLKVGDVFVFPKALFHFFLNTDFEEATVFSVYNSQNPGFVSLSPTTFDTTLESLDKIKKRLISLSASEAQAQAQDVNSFISPELETIYS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo