SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g31750

Feature Type:gene_model
Chromosome:Gm15
Start:35190687
stop:35194259
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g31750
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G79340AT Annotation by Michelle Graham. TAIR10: metacaspase 4 | chr1:29842849-29844368 FORWARD LENGTH=418 SoyBaseE_val: 0ISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0016540GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoprocessing SoyBaseN/AISS
GO:0043068GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of programmed cell death SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0004197GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type endopeptidase activity SoyBaseN/AISS
GO:0008234GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity SoyBaseN/AISS
GO:0042802GO-mf Annotation by Michelle Graham. GO Molecular Function: identical protein binding SoyBaseN/AISS
KOG1546 KOG Metacaspase involved in regulation of apoptosis JGI ISS
PF00656PFAM Caspase domain JGI ISS
UniRef100_B9RYK8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Caspase, putative n=1 Tax=Ricinus communis RepID=B9RYK8_RICCO SoyBaseE_val: 0ISS
UniRef100_I1MIC1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MIC1_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g31750
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g31750 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g219100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g31750
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g31750
>Glyma15g31750.1   sequence type=CDS   gene model=Glyma15g31750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAAAAAGGCAGTGTTGATCGGAATAAACTACCCAGGAACAAAGGCGGAGCTGAGAGGATGCATAAACGACGTGTGGAGAATGCATCGCTGCCTGATCGAGCGATACGGTTTCTCCGAAGACGACATCACCGTTTTGATCGACACGGACGAGTCCTACACGGAGCCCACCGGGAAGAACATCCGGTCAGCGCTGACCAGGCTGGTCCGATCGGCGGAGCCCGGGGACGTTCTGTTTGTGCACTACAGCGGACACGGCACGCGCCTCCCCGCGGAAACCGGAGAGGACGATGACACTGGTTATGATGAATGCATTGTTCCTTCTGACATGAACCTTATCACCGATGATGATTTCAGAGAATTTGTTGATGGGGTCCCTAGAGGTTGCAGGATCACAATTGTGTCTGATTCTTGCCACAGTGGTGGCCTACTTGAAGAAGCTAAGGAGCAGATAGGAGAGAGCACAAAGGGAGAGGAGGAACAATCTAGCTCTGGCTTTGGATTTTCAAGTTTTCTACATCGGACTGTGGAAGATGCCATTGAGTCTCGCGGATTCCATATCCCTTCAGCGTTGCGCCACAACAGAGGCAGGGATGATGATGGTGATGAAGCTCAAAATAGGGATATTGAACTTCCGGATGGGGGCTATGTAAAGAACAGGTCTTTGCCCCTTTCAACCCTCATTGATATACTCAAGCAGAAAACTGGGAAAGATGATATAGATGTTGGGAAACTGAGACCTACCCTTTTCGATGTTTTTGGGGAAGATGCTAGTCCTAAAGTGAAAAAGTTCATGAATGTTATTTTTAACAAACTCCAACATGGAAGTGATGAAAGTGGGGGTGGAATATTGGGGCTGGTGGGTGGTCTTGCCCAAGAGTTTCTCAAGCAAAAGCTTGATGACAATGATGAGGGATATGCAAAGCCTGCACTGGAGACAAAAGTGGAAAGTAAGCATGAGGCATACGCTGGACCAACCAAACGCGGCCTTCCGGATGGTGGGATATTGATGAGTGGATGTCAGACTGACCAAACTTCTGCAGATGCAAGTCCTGCAGGCAACGCTGCCAGTGCTTATGGTGCTTTTAGCAATGCGATACAGGCTATAATTGAGGAGACTGATGGTGCAATCACAAACCAAGAACTTGTTCAAAGGGCAAGAGAGAAGCTGAAGAACTCCGGTTTCACACAAAAACCTGGACTCTATTGCAGTGATCACCATGTTGATGCTCCTTTTGTGTGTTGA
Predicted protein sequences of Glyma15g31750
>Glyma15g31750.1   sequence type=predicted peptide   gene model=Glyma15g31750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKKAVLIGINYPGTKAELRGCINDVWRMHRCLIERYGFSEDDITVLIDTDESYTEPTGKNIRSALTRLVRSAEPGDVLFVHYSGHGTRLPAETGEDDDTGYDECIVPSDMNLITDDDFREFVDGVPRGCRITIVSDSCHSGGLLEEAKEQIGESTKGEEEQSSSGFGFSSFLHRTVEDAIESRGFHIPSALRHNRGRDDDGDEAQNRDIELPDGGYVKNRSLPLSTLIDILKQKTGKDDIDVGKLRPTLFDVFGEDASPKVKKFMNVIFNKLQHGSDESGGGILGLVGGLAQEFLKQKLDDNDEGYAKPALETKVESKHEAYAGPTKRGLPDGGILMSGCQTDQTSADASPAGNAASAYGAFSNAIQAIIEETDGAITNQELVQRAREKLKNSGFTQKPGLYCSDHHVDAPFVC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo