Glyma15g31750 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g31750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g31750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g31750

Feature Type:	gene_model
Chromosome:	Gm15
Start:	35190687
stop:	35194259
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g31750

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G79340	AT	Annotation by Michelle Graham. TAIR10: metacaspase 4 \| chr1:29842849-29844368 FORWARD LENGTH=418	SoyBase	E_val: 0	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0006816	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium ion transport	SoyBase	N/A	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0007033	GO-bp	Annotation by Michelle Graham. GO Biological Process: vacuole organization	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009805	GO-bp	Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016540	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein autoprocessing	SoyBase	N/A	ISS
GO:0043068	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of programmed cell death	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0048767	GO-bp	Annotation by Michelle Graham. GO Biological Process: root hair elongation	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0004197	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine-type endopeptidase activity	SoyBase	N/A	ISS
GO:0008234	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity	SoyBase	N/A	ISS
GO:0042802	GO-mf	Annotation by Michelle Graham. GO Molecular Function: identical protein binding	SoyBase	N/A	ISS
KOG1546	KOG	Metacaspase involved in regulation of apoptosis	JGI		ISS
PF00656	PFAM	Caspase domain	JGI		ISS
UniRef100_B9RYK8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Caspase, putative n=1 Tax=Ricinus communis RepID=B9RYK8_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1MIC1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MIC1_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma15g31750

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g31750 not represented in the dataset	Glyma15g31750 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g31750 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g219100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g31750

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g31750

Limit To All Plant Sequences

>Glyma15g31750.1   sequence type=CDS   gene model=Glyma15g31750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAAAAAGGCAGTGTTGATCGGAATAAACTACCCAGGAACAAAGGCGGAGCTGAGAGGATGCATAAACGACGTGTGGAGAATGCATCGCTGCCTGATCGAGCGATACGGTTTCTCCGAAGACGACATCACCGTTTTGATCGACACGGACGAGTCCTACACGGAGCCCACCGGGAAGAACATCCGGTCAGCGCTGACCAGGCTGGTCCGATCGGCGGAGCCCGGGGACGTTCTGTTTGTGCACTACAGCGGACACGGCACGCGCCTCCCCGCGGAAACCGGAGAGGACGATGACACTGGTTATGATGAATGCATTGTTCCTTCTGACATGAACCTTATCACCGATGATGATTTCAGAGAATTTGTTGATGGGGTCCCTAGAGGTTGCAGGATCACAATTGTGTCTGATTCTTGCCACAGTGGTGGCCTACTTGAAGAAGCTAAGGAGCAGATAGGAGAGAGCACAAAGGGAGAGGAGGAACAATCTAGCTCTGGCTTTGGATTTTCAAGTTTTCTACATCGGACTGTGGAAGATGCCATTGAGTCTCGCGGATTCCATATCCCTTCAGCGTTGCGCCACAACAGAGGCAGGGATGATGATGGTGATGAAGCTCAAAATAGGGATATTGAACTTCCGGATGGGGGCTATGTAAAGAACAGGTCTTTGCCCCTTTCAACCCTCATTGATATACTCAAGCAGAAAACTGGGAAAGATGATATAGATGTTGGGAAACTGAGACCTACCCTTTTCGATGTTTTTGGGGAAGATGCTAGTCCTAAAGTGAAAAAGTTCATGAATGTTATTTTTAACAAACTCCAACATGGAAGTGATGAAAGTGGGGGTGGAATATTGGGGCTGGTGGGTGGTCTTGCCCAAGAGTTTCTCAAGCAAAAGCTTGATGACAATGATGAGGGATATGCAAAGCCTGCACTGGAGACAAAAGTGGAAAGTAAGCATGAGGCATACGCTGGACCAACCAAACGCGGCCTTCCGGATGGTGGGATATTGATGAGTGGATGTCAGACTGACCAAACTTCTGCAGATGCAAGTCCTGCAGGCAACGCTGCCAGTGCTTATGGTGCTTTTAGCAATGCGATACAGGCTATAATTGAGGAGACTGATGGTGCAATCACAAACCAAGAACTTGTTCAAAGGGCAAGAGAGAAGCTGAAGAACTCCGGTTTCACACAAAAACCTGGACTCTATTGCAGTGATCACCATGTTGATGCTCCTTTTGTGTGTTGA

Predicted protein sequences of Glyma15g31750

Limit To All Plant Sequences

>Glyma15g31750.1   sequence type=predicted peptide   gene model=Glyma15g31750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKKAVLIGINYPGTKAELRGCINDVWRMHRCLIERYGFSEDDITVLIDTDESYTEPTGKNIRSALTRLVRSAEPGDVLFVHYSGHGTRLPAETGEDDDTGYDECIVPSDMNLITDDDFREFVDGVPRGCRITIVSDSCHSGGLLEEAKEQIGESTKGEEEQSSSGFGFSSFLHRTVEDAIESRGFHIPSALRHNRGRDDDGDEAQNRDIELPDGGYVKNRSLPLSTLIDILKQKTGKDDIDVGKLRPTLFDVFGEDASPKVKKFMNVIFNKLQHGSDESGGGILGLVGGLAQEFLKQKLDDNDEGYAKPALETKVESKHEAYAGPTKRGLPDGGILMSGCQTDQTSADASPAGNAASAYGAFSNAIQAIIEETDGAITNQELVQRAREKLKNSGFTQKPGLYCSDHHVDAPFVC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain