SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g31040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g31040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g31040

Feature Type:gene_model
Chromosome:Gm15
Start:34385848
stop:34389259
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g31040
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G49870AT Annotation by Michelle Graham. TAIR10: unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage, D bilateral stage; Has 6518 Blast hits to 5022 proteins in 522 species: Archae - 49; Bacteria - 635; Metazoa - 3264; Fungi - 379; Plants - 242; Viruses - 9; Other Eukaryotes - 1940 (source: NCBI BLink). | chr1:18460345-18463557 FORWARD LENGTH=828 SoyBaseE_val: 1.00E-20ISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
UniRef100_I1NG12UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1NG12_SOYBN SoyBaseE_val: 3.00E-28ISS
UniRef100_Q6AUY1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=2 Tax=Oryza sativa RepID=Q6AUY1_ORYSJ SoyBaseE_val: 2.00E-16ISS

Expression Patterns of Glyma15g31040
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g31040 not represented in the dataset
Glyma15g31040 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g31040 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma15g31040
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g31040
>Glyma15g31040.1   sequence type=CDS   gene model=Glyma15g31040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAAACAGATACAGGCCATCAAAGTGTGTCATTGGAGAACAAGACAGGAGATTCAACTGTGCTGAAGATAGGAGATTTGGCTAAAGTTGTGATAAAACAAGACATGAAGGGAGGAGAGCATAAATATGGGTTTAACAACAATAAACGTGAGAAGCCAAAGAAGGTGAGGCTACATCAAGTGCTCTTAACAAGGTCAAATCACAAATTAGAAAGACTACCCGTCGTAAAACCTCTCCTATTAACTGCTTCCTACGTAAAAAAATGGGATACCTACATGAATAGGAAAATTAAGATGCTTCAGGAAGTAGATGGTATGAATTTGACGCTTGATCAGACTCTTGGTAGTTCTAACCCACATTATTCAAGAGTGTTGAGAGAGAAAATGGCAGCTAGAGAAGCGGCACATAAGGGAATGGAGGCTCGAAGAGCAGCATAA
Predicted protein sequences of Glyma15g31040
>Glyma15g31040.1   sequence type=predicted peptide   gene model=Glyma15g31040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKTDTGHQSVSLENKTGDSTVLKIGDLAKVVIKQDMKGGEHKYGFNNNKREKPKKVRLHQVLLTRSNHKLERLPVVKPLLLTASYVKKWDTYMNRKIKMLQEVDGMNLTLDQTLGSSNPHYSRVLREKMAAREAAHKGMEARRAA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo