SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g26590

Feature Type:gene_model
Chromosome:Gm15
Start:28609413
stop:28611445
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g26590
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G58070AT Annotation by Michelle Graham. TAIR10: temperature-induced lipocalin | chr5:23500512-23501156 REVERSE LENGTH=186 SoyBaseE_val: 8.00E-96ISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
KOG4824 KOG Apolipoprotein D/Lipocalin JGI ISS
PTHR10612Panther LIPOCALIN/APOLIPOPROTEIN D JGI ISS
PTHR10612:SF7Panther OUTER MEMBRANE LIPOPROTEIN BLC JGI ISS
PF08212PFAM Lipocalin-like domain JGI ISS
UniRef100_Q38JE0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Temperature-induced lipocalin' n=1 Tax=Glycine max RepID=Q38JE0_SOYBN SoyBaseE_val: 3.00E-134ISS
UniRef100_Q38JE0UniRef Annotation by Michelle Graham. Best UniRef hit: Temperature-induced lipocalin' n=1 Tax=Glycine max RepID=Q38JE0_SOYBN SoyBaseE_val: 3.00E-134ISS

Expression Patterns of Glyma15g26590
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g26590 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g205900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g26590
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g26590
>Glyma15g26590.1   sequence type=CDS   gene model=Glyma15g26590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACAACGAGATGCAAGTTGAGAGGGGTTTGGACTTGGAAAGGTACATGGGGCGTTGGTATGAGATAGCCTCTTTCCCTTCAAGGAACCAGCCCAAGGATGGCGTGAACACCAGAGCCACATACACTCTTAGGAATGATGGCACTGTGCAAGTGCTCAACGAGACTTGGAGTAATGGCAAGAGAGGGCACATAGAGGGAACTGCTTTTAAGTCTAACCGCACAAGTGATGAGGCCAAGTTCAAGGTCAAGTTTTATGTCCCTCCCTTTTTGCCTATCATTCCTGTAACAGGGGACTACTGGGTTTTGTTCATTGATGGTGATTACCAGTACGCTTTGATTGGCCAACCAAGCAGGAATTGCCTTTGGATATTAAGCAGGAAACCCCATCTGGATGATGAGATCTACAACAAGCTTGTTCAGAGAGCTAAGGATGTAGGATATGATGTGAGCAAACTCCACAAGACCCCACAGAGCGATCCTCCACCAGAGGAAGAAGGCCCCCAAGACACAAAAGGCATTTGGTGGCTCAAATCCATTTTGGGGAAATAG
Predicted protein sequences of Glyma15g26590
>Glyma15g26590.1   sequence type=predicted peptide   gene model=Glyma15g26590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANNEMQVERGLDLERYMGRWYEIASFPSRNQPKDGVNTRATYTLRNDGTVQVLNETWSNGKRGHIEGTAFKSNRTSDEAKFKVKFYVPPFLPIIPVTGDYWVLFIDGDYQYALIGQPSRNCLWILSRKPHLDDEIYNKLVQRAKDVGYDVSKLHKTPQSDPPPEEEGPQDTKGIWWLKSILGK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo