SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g24750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g24750): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g24750

Feature Type:gene_model
Chromosome:Gm15
Start:25891757
stop:25895367
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g24750
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G24290AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF1068) | chr2:10338779-10339859 FORWARD LENGTH=173 SoyBaseE_val: 3.00E-83ISS
GO:0000394GO-bp Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009086GO-bp Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PTHR17695Panther UNCHARACTERIZED JGI ISS
PTHR17695:SF1Panther gb def: putative protein [arabidopsis thaliana] JGI ISS
PF06364PFAM Protein of unknown function (DUF1068) JGI ISS
UniRef100_C6T487UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T487_SOYBN SoyBaseE_val: 4.00E-128ISS
UniRef100_Q9ZQ38UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Arabidopsis thaliana RepID=Q9ZQ38_ARATH SoyBaseE_val: 1.00E-80ISS

Expression Patterns of Glyma15g24750
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g24750 not represented in the dataset
Glyma15g24750 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g24750 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g206000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g24750
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g24750
>Glyma15g24750.1   sequence type=CDS   gene model=Glyma15g24750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCACGGGGGAGATCTGATTCGGGAGGGTGGTTGAGGGGCTGTTTGGTGGTGTTTGCAGTGGTCTCAGCGTTGGGTGTGTGTGGGCCTGCTCTCTATTGGCGATTCAAAAACGCAATCACTCTTCGCAATTCCCACAGCAGCAAACTCTCTTGCCCTCCCTGCCTCTGTGATTGCCCTCCCCCTCTCTCGCTCTTCCAACTCGCTCCTGGGTTGGCCAATCTCTCTATCTCAGATTGTGGAAGTAATGACCCGGATCTGAAGGAGGAGATGGAGAAGCAGTTTGTGGACCTTCTCAGTGAGGAGTTGAAGTTGCAAGAGTCTGTTACTGAAGCAAACACCCGGCACATGAACATAACTTTGGCTGAAGCAAAAAGAGTGGCTTCTCAGTACCAGAGAGAGGCAGATAAATGCATTGCTGCAACTGAAACATGCGAGCAGGCAAGAGAACGTGCTCAGGCCATACTTACCAAGGAGAAAAAGATGACTTTGGTGTGGGAGAAACGAGCTCGTCAAATGGGTTGGGAAGGAGAATAA
Predicted protein sequences of Glyma15g24750
>Glyma15g24750.1   sequence type=predicted peptide   gene model=Glyma15g24750   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRGRSDSGGWLRGCLVVFAVVSALGVCGPALYWRFKNAITLRNSHSSKLSCPPCLCDCPPPLSLFQLAPGLANLSISDCGSNDPDLKEEMEKQFVDLLSEELKLQESVTEANTRHMNITLAEAKRVASQYQREADKCIAATETCEQARERAQAILTKEKKMTLVWEKRARQMGWEGE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo