SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g23983): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g23983): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g23983

Feature Type:gene_model
Chromosome:Gm15
Start:24407873
stop:24409776
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G19250AT Annotation by Michelle Graham. TAIR10: flavin-dependent monooxygenase 1 | chr1:6650656-6653053 REVERSE LENGTH=530 SoyBaseE_val: 1.00E-14ISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009870GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-dependent SoyBaseN/AISS
GO:0010204GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0071456GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to hypoxia SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0031227GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intrinsic to endoplasmic reticulum membrane SoyBaseN/AISS
GO:0004497GO-mf Annotation by Michelle Graham. GO Molecular Function: monooxygenase activity SoyBaseN/AISS
GO:0004499GO-mf Annotation by Michelle Graham. GO Molecular Function: N,N-dimethylaniline monooxygenase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
GO:0050661GO-mf Annotation by Michelle Graham. GO Molecular Function: NADP binding SoyBaseN/AISS
PTHR23023Panther DIMETHYLANILINE MONOOXYGENASE JGI ISS
PTHR23023:SF18Panther SUBFAMILY NOT NAMED JGI ISS
PF00743PFAM Flavin-binding monooxygenase-like JGI ISS
UniRef100_B9T603UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dimethylaniline monooxygenase, putative n=1 Tax=Ricinus communis RepID=B9T603_RICCO SoyBaseE_val: 2.00E-34ISS
UniRef100_UPI000233BEB5UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233BEB5 related cluster n=1 Tax=unknown RepID=UPI000233BEB5 SoyBaseE_val: 4.00E-118ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g23983 not represented in the dataset

Glyma15g23983 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g200700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g23983.1   sequence type=CDS   gene model=Glyma15g23983   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATCCACGAAACTCCAAAACACTAAACCAACGTACCAGTTTATAGATTTTCCATGGCCTTCTTCAGTTAAAGAACATAATCCAAGTCACAACCAAGTGCTAGATTATCTTAACTCCTATGCTGAACATTTTCCCCTCATTCCTTACATTAGGTTCAACTCCAATGTCATCGATATAGATTATGCTGGAGAGTCTAGTGAAGAAATGAAATCATGGGAATTGTGGGGTGGTAATGGCAGGCCCTTCTGCTCCAAGGGAACTTGGCATATTGCTATGCAAGATACCAAGAATTTATCCATAGAGAGATCGGGAATTTCTAAACTTGTTGAAACTATTCTAAAATGGAAGCTGTCATTAAAGAAGTATGGATTGGTACCCAATCACAGCTTTCTTCAAGATCTCTTCACATGTCTGCTTGGAGTGTTTCCTGATAACTTCTTTGACAAACTAAAAGAAGGATCCATTCTTATGAAGAAATCACAAAGCTTTAGCTTATGTAGAGAAGGTGTAATCATTGATGGAGAAAGCCCCTAG

>Glyma15g23983.1   sequence type=predicted peptide   gene model=Glyma15g23983   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESTKLQNTKPTYQFIDFPWPSSVKEHNPSHNQVLDYLNSYAEHFPLIPYIRFNSNVIDIDYAGESSEEMKSWELWGGNGRPFCSKGTWHIAMQDTKNLSIERSGISKLVETILKWKLSLKKYGLVPNHSFLQDLFTCLLGVFPDNFFDKLKEGSILMKKSQSFSLCREGVIIDGESP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo