SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g23620): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g23620): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g23620

Feature Type:gene_model
Chromosome:Gm15
Start:23231528
stop:23232515
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g23620
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11490AT Annotation by Michelle Graham. TAIR10: rac GTPase activating protein | chr3:3617523-3619567 REVERSE LENGTH=435 SoyBaseE_val: 1.00E-68ISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
PTHR23177Panther MKIAA1688 PROTEIN JGI ISS
PTHR23177:SF2Panther GTPASE ACTIVATING PROTEIN JGI ISS
PF00620PFAM RhoGAP domain JGI ISS
UniRef100_I1MHX3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MHX3_SOYBN SoyBaseE_val: 1.00E-113ISS
UniRef100_Q2HTG0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Rho GTPase-activating protein n=1 Tax=Medicago truncatula RepID=Q2HTG0_MEDTR SoyBaseE_val: 4.00E-74ISS

Expression Patterns of Glyma15g23620
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g23620 not represented in the dataset
Glyma15g23620 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g23620 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma15g23620
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g23620
>Glyma15g23620.1   sequence type=CDS   gene model=Glyma15g23620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGTGCAAATGTTTTTGGAGTTTCAACAGAATCTATGCAGCTTTCTTTTGATGCCAGAGGGAATAGTGTACCTACAATACTGCTGTTAATGCAAAGACATTTGTATGCACAAGGAGGTCTGCAGGCTGAAGGAATCTTTAGAATTGATGCTGAAAATGGTCAAGAGGAATTTATTTGGTCTTGGATTGTTGGATTTTGGTCTGGTCTCTTATTTGAAAGTTGTCCAGGTGAATTTAATAAATACACTAATGCTTGGTTTAGAGAACTACCAACTAGAGTATTGGACCCTTTTTCGCCAGAGCAGGTGATGCAATCCCAGTCAGAAGAAGAATGTGCTCAGCTTGTGAGGCTTCTTCCTCCAACAGAAGTTGCTTTGCTAGATTGGGCAATAAATTTAATGGCAGATGTTACTCAAATGGAAAACTTGAACAACATGAATGCACGTAATATTGCAATGGTTTTTGCGCCAAACATGACTCAA
Predicted protein sequences of Glyma15g23620
>Glyma15g23620.1   sequence type=predicted peptide   gene model=Glyma15g23620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
SANVFGVSTESMQLSFDARGNSVPTILLLMQRHLYAQGGLQAEGIFRIDAENGQEEFIWSWIVGFWSGLLFESCPGEFNKYTNAWFRELPTRVLDPFSPEQVMQSQSEEECAQLVRLLPPTEVALLDWAINLMADVTQMENLNNMNARNIAMVFAPNMTQ






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo