Glyma15g23580 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g23580

Feature Type:	gene_model
Chromosome:	Gm15
Start:	23165947
stop:	23170024
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g23580

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G35080	AT	Annotation by Michelle Graham. TAIR10: INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). \| chr5:13354552-133567	SoyBase	E_val: 2.00E-114	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0030244	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellulose biosynthetic process	SoyBase	N/A	ISS
GO:0030433	GO-bp	Annotation by Michelle Graham. GO Biological Process: ER-associated protein catabolic process	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0048193	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
PTHR15414	Panther	OS-9-RELATED	JGI		ISS
PF07915	PFAM	Glucosidase II beta subunit-like protein	JGI		ISS
UniRef100_I1MHX1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MHX1_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q8GWH3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein OS-9 n=1 Tax=Arabidopsis thaliana RepID=Q8GWH3_ARATH	SoyBase	E_val: 1.00E-111	ISS

Expression Patterns of Glyma15g23580

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g23580

Paralog	Evidence	Comments
Glyma09g12020	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g23580 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g198100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g23580

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g23580

Limit To All Plant Sequences

>Glyma15g23580.1   sequence type=CDS   gene model=Glyma15g23580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGGCGCTGTTTCTGTTCTTCGTTCTCTTCTCTTTCAGCTATGCCACCGAACAAATCTTTCCTGCTCATATCGGTAGCATTTTCGGTGGTGGCGGTGGTGGCCGCTCTCGCGAACCCAAATACAAGATCGAATTTCATCCCGAAGATTCCCCTTTTCACCCTGATGATGATCAGGAATCTATAGTCATGCCGGATAAAACTGGACAGAAATATATATGTTACTTACCTAAAGTGGAAAAGGAAAAAAGTGGAAAGCCTGTTATCCAACACAATATTAGCAGCATGATTGTGGAAACTGAGAAAAGGATTAAGCAGAAGACACCAGATGAACTGCTAGAAGTATTAAGGGGTCCATGTTTTCTCAGACAAGAAGGTTGGTGGTCATATGAATTTTGCTATCAAAAGAAGTTGAGGCAACTACATCTGGAGGATGATAAGGTTGTCCAGGAGTTTGTCTTGGGAGTGTATGATCCGGAGGCTACAGCTGCATTTAACGAAAATCTGTCCGACATTTCTACATTGAAGGATCCCCGGTCAAAAGATGCATCTCAAAGGTATCATGCTCATCAATATACTAATGGCACCGTATGTGATCTTACAAATAAGCCACGAGAGACCGAGGTGAGGTTTGTATGCTCTGAACCGAGAGCAATGATTAGTTCAATCACAGAGATTTCCACTTGCAAGTATGCACTTACAGTGCAATGTCCGCAGCTATGCAAGCACCCATTATTTCAAGAGGAGAGACCAGTATGGCACACCATCGACTGTAATGTGCTTCCAAAAGATCACGTGGATGCCAAAGTGAGACGACAAAACGAAAATACGGAGATTGTTATAGTGAAAGACTTCGAAAATAGTGACTTAGAGTCAGAACAATGA

Predicted protein sequences of Glyma15g23580

Limit To All Plant Sequences

>Glyma15g23580.1   sequence type=predicted peptide   gene model=Glyma15g23580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRALFLFFVLFSFSYATEQIFPAHIGSIFGGGGGGRSREPKYKIEFHPEDSPFHPDDDQESIVMPDKTGQKYICYLPKVEKEKSGKPVIQHNISSMIVETEKRIKQKTPDELLEVLRGPCFLRQEGWWSYEFCYQKKLRQLHLEDDKVVQEFVLGVYDPEATAAFNENLSDISTLKDPRSKDASQRYHAHQYTNGTVCDLTNKPRETEVRFVCSEPRAMISSITEISTCKYALTVQCPQLCKHPLFQEERPVWHTIDCNVLPKDHVDAKVRRQNENTEIVIVKDFENSDLESEQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain