SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g22332

Feature Type:gene_model
Chromosome:Gm15
Start:20932748
stop:20933309
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g22332
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48880AT Annotation by Michelle Graham. TAIR10: RNI-like superfamily protein | chr3:18127873-18129008 FORWARD LENGTH=309 SoyBaseE_val: 7.00E-16ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_G7KZ81UniRef Annotation by Michelle Graham. Most informative UniRef hit: F-box/LRR-repeat protein n=1 Tax=Medicago truncatula RepID=G7KZ81_MEDTR SoyBaseE_val: 8.00E-36ISS
UniRef100_I1MHS6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MHS6_SOYBN SoyBaseE_val: 6.00E-101ISS

Expression Patterns of Glyma15g22332
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g22332 not represented in the dataset
Glyma15g22332 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g22332 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma15g22332
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g22332
>Glyma15g22332.1   sequence type=CDS   gene model=Glyma15g22332   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATGTCTTCTTATGTAGGACCCCAAATCTGAAACAACTAGTTCTACCAAGGAAAGGTGACTTTTCAAGAAAAGCAGTGCATATGGCAATGAAGTCATGGGGAGGCCTTGAGTCCATTAACATTAGCTCTGGTGTCCCCACTGATTACATATTTCCTGCAATTCACGAATACTGTAAGAGTGTCAATGGGATCAAATTCCATTGTGAATTTGAAGAAAAGCACGCAGAAGCCTTGATTGAATCTACCCCTAACTTGAAGGTGTTCAGCATTCGGTCCACGGTAGTGAGCATGAAGGCTTTGAGGAGTGTGCTCACTTCCGTGGAACATTTGGAGGCGGTGAATATCTATCACAGCTTCATTGTGGATATGTCGCATGATGAATTCAGTATTTTTGCAATTCAAGATCTACATAACATTGCACTTGGTTCTTTTCTCTACCGTGCACTAGATATCTGGCGGGAGGATGAGATCACCTCTTTGGCACATTAA
Predicted protein sequences of Glyma15g22332
>Glyma15g22332.1   sequence type=predicted peptide   gene model=Glyma15g22332   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHVFLCRTPNLKQLVLPRKGDFSRKAVHMAMKSWGGLESINISSGVPTDYIFPAIHEYCKSVNGIKFHCEFEEKHAEALIESTPNLKVFSIRSTVVSMKALRSVLTSVEHLEAVNIYHSFIVDMSHDEFSIFAIQDLHNIALGSFLYRALDIWREDEITSLAH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo