Glyma15g21101 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g21101

Feature Type:	gene_model
Chromosome:	Gm15
Start:	19312624
stop:	19320437
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g21101

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G06620	AT	Annotation by Michelle Graham. TAIR10: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein \| chr1:2025618-2027094 FORWARD LENGTH=365	SoyBase	E_val: 6.00E-74	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0016706	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors	SoyBase	N/A	ISS
PTHR10209	Panther	FE(II)/ ASCORBATE OXIDASE SUPERFAMILY	JGI		ISS
PTHR10209:SF55	Panther	OXIDOREDUCTASE, 2OG-FE(II) OXYGENASE FAMILY PROTEI	JGI		ISS
PF03171	PFAM	2OG-Fe(II) oxygenase superfamily	JGI		ISS
UniRef100_G7I471	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 1-aminocyclopropane-1-carboxylate oxidase-like protein (Fragment) n=1 Tax=Medicago truncatula RepID=G7I471_MEDTR	SoyBase	E_val: 2.00E-90	ISS
UniRef100_I1L3C2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L3C2_SOYBN	SoyBase	E_val: 3.00E-124	ISS

Expression Patterns of Glyma15g21101

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g21101 not represented in the dataset	Glyma15g21101 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g21101 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma15g21101

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g21101

Limit To All Plant Sequences

>Glyma15g21101.1   sequence type=CDS   gene model=Glyma15g21101   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAAGTGCACTAAAGGAAATAGTAGAGTACCAAACACAAATTAATATACGGTTAGATGTAGTAAGGATTGTGCATGTTGAAGTGGTTGACCAGATTAGGAGTGCATCTCAAAAGTTAGGATTTTTCCAAGGGAACAATCATGGCATTCCTGTGGAGGTTTTGGATGAGATGATCAGTGGAATCCGAAGCCCTTTTTACTCAAGAGATAGCGGTAAGAAAGTCAGGTATTTTTCTAATGGGAAGCTGTTTAGAGACATGACTGGTACTTGGAGGGACACAATTGCATTTGATGTGAATCCAGATCCCCCAAAGCCACAAGATATACCAGCAGTGTGTAGAGATATTGTGGCTGAGTATTCTAAACAACTAAAAGCGTTAGGTGCCACGATCTTTGAGCTACTGTCAAAGGCTCTTGGCCTTAATCCTTCCTACCTTGAAGAAATGGATTGCACTAAAGCACTTTATGTTATGGGTCAGTACTATCCTGAATTCCCTGAACCTGAATTAACTCTTGGAATTTCAAACCACACTGATTGTGACTTCATAACAATACTTTTGCAAGATCAGATAGGTGGTCTTCAAGTTCTTCATGAGAATCATTGGGTTAATGTTTCTCCAGTGCAAGGAGCTCTTGTTGTAAACATTGGAGATATTCTGCATATAACTTCTGAAATT

Predicted protein sequences of Glyma15g21101

Limit To All Plant Sequences

>Glyma15g21101.1   sequence type=predicted peptide   gene model=Glyma15g21101   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTSALKEIVEYQTQINIRLDVVRIVHVEVVDQIRSASQKLGFFQGNNHGIPVEVLDEMISGIRSPFYSRDSGKKVRYFSNGKLFRDMTGTWRDTIAFDVNPDPPKPQDIPAVCRDIVAEYSKQLKALGATIFELLSKALGLNPSYLEEMDCTKALYVMGQYYPEFPEPELTLGISNHTDCDFITILLQDQIGGLQVLHENHWVNVSPVQGALVVNIGDILHITSEI

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain