SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g20935): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g20935): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g20935

Feature Type:gene_model
Chromosome:Gm15
Start:19011461
stop:19013314
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G22970AT Annotation by Michelle Graham. TAIR10: homolog of separase | chr4:12033703-12043572 REVERSE LENGTH=2177 SoyBaseE_val: 4.00E-65ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006259GO-bp Annotation by Michelle Graham. GO Biological Process: DNA metabolic process SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006302GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0008284GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0009960GO-bp Annotation by Michelle Graham. GO Biological Process: endosperm development SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0045876GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of sister chromatid cohesion SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051276GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome organization SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0051304GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome separation SoyBaseN/AISS
GO:0051307GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome separation SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008233GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidase activity SoyBaseN/AISS
UniRef100_G7IK10UniRef Annotation by Michelle Graham. Most informative UniRef hit: Separin n=1 Tax=Medicago truncatula RepID=G7IK10_MEDTR SoyBaseE_val: 2.00E-118ISS
UniRef100_UPI000233B473UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B473 related cluster n=1 Tax=unknown RepID=UPI000233B473 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g20935 not represented in the dataset

Glyma15g20935 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g20935.1   sequence type=CDS   gene model=Glyma15g20935   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCGAGTCCCTCGGAATCCTCCCTCATCTCCAAGCTTCAGTCCTCCGATTCCCCCGACATCCATGCCCTGGTCTCTGATTACCTCCATCCCCTGTCAGATCTCAAGCCAACCAAAAAATCCAACCCCGACCAAACCCTAATTCGCTCACTCGCCAAGTGTTTTCTCTCCTTCCTCAACGCCTCCTTATCCATCCTCCCAAAATGGTTCCTTGAGGTCTCCAAGTCTAACAACGTCGTCTCCCTCCTCGAGTTACTCCGTGTTTACAAGATCTGCCTCGATTGCTTGGACGTTGTCGCTTCTCAATTGGGTTCTAAGCCCTTCTTCGTCGAGTTCCAACGACTTCGCCTGATTCACTGCCTCGAGTCATGTGGCCTATTTGACGAAGCCCAACTTGAGGGTTTAGGGGTTTTAGAGAAGCCTCCACCCGCCAAGTGGAAGGGTAAGCTTCTCCCTGAAATAGACAAGGGCAGTGGAGAGGGTAAAGAATTGTGCTCTTTGGTCGTTGATATTGTTGTGAGCCTCCTGAGGTGTGCAACCGCGGGTTTGGCTAAAAAGGATGCCCATTTCAGGAAGGTGCTTTTGTTGGTGGAGGAAGTAAGCCCTTGGCTTAGATTGGATTCCAATTCGTATGAGAAGTTGCACAAGATGTTAGTAACTCATTTGGGCAAGTGCACTTTAAATTTATTGGGGAGTACGCCATTTCCAGATAGATACTTGGTGACCTTGTTTTGGTGTACAACGTTGACTGAATATGTGAAATCTCCCATCAAAGATCAAGTCTACAAGATTGCCCTCAGGGTATGCTCATTATTGTTTGCACTGAGGGATAATAACTCCTTGTATATCATGGATATACTAGAATCCATAGTTCGCGAGTGCAAGGTTGAGGAGGAAAACACAGGAACCAACTTTGTTGAACTTGTATATTACTGTGCAAATAAATGTCAAACTGCAAATGAAAGTTTTTGTAGTACATTTGCAGCATATTTGAACAAAATAGCAGAACATTTCAAACAAGTTATGACACCCATAAATTCAATACTGAGGCTTTATGCTGCTGGATTGCTCCTTGTTTGTTGTAATTTGAGGTCCAGAGCTAGAGATCTAGCATCCTCTGGTAGTGCAAAATTTGAGTGTTTGCTTGGGACTTTACTAGAAAACAAGAAAATACTACAGCGTTTCGGATCTTGA

>Glyma15g20935.1   sequence type=predicted peptide   gene model=Glyma15g20935   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ASPSESSLISKLQSSDSPDIHALVSDYLHPLSDLKPTKKSNPDQTLIRSLAKCFLSFLNASLSILPKWFLEVSKSNNVVSLLELLRVYKICLDCLDVVASQLGSKPFFVEFQRLRLIHCLESCGLFDEAQLEGLGVLEKPPPAKWKGKLLPEIDKGSGEGKELCSLVVDIVVSLLRCATAGLAKKDAHFRKVLLLVEEVSPWLRLDSNSYEKLHKMLVTHLGKCTLNLLGSTPFPDRYLVTLFWCTTLTEYVKSPIKDQVYKIALRVCSLLFALRDNNSLYIMDILESIVRECKVEEENTGTNFVELVYYCANKCQTANESFCSTFAAYLNKIAEHFKQVMTPINSILRLYAAGLLLVCCNLRSRARDLASSGSAKFECLLGTLLENKKILQRFGS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo