|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT4G22970 | AT | Annotation by Michelle Graham. TAIR10: homolog of separase | chr4:12033703-12043572 REVERSE LENGTH=2177 | SoyBase | E_val: 4.00E-65 | ISS |
GO:0000003 | GO-bp | Annotation by Michelle Graham. GO Biological Process: reproduction | SoyBase | N/A | ISS |
GO:0000087 | GO-bp | Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle | SoyBase | N/A | ISS |
GO:0000280 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nuclear division | SoyBase | N/A | ISS |
GO:0000911 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation | SoyBase | N/A | ISS |
GO:0006259 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA metabolic process | SoyBase | N/A | ISS |
GO:0006275 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication | SoyBase | N/A | ISS |
GO:0006302 | GO-bp | Annotation by Michelle Graham. GO Biological Process: double-strand break repair | SoyBase | N/A | ISS |
GO:0006310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA recombination | SoyBase | N/A | ISS |
GO:0006312 | GO-bp | Annotation by Michelle Graham. GO Biological Process: mitotic recombination | SoyBase | N/A | ISS |
GO:0006325 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin organization | SoyBase | N/A | ISS |
GO:0006342 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin silencing | SoyBase | N/A | ISS |
GO:0006396 | GO-bp | Annotation by Michelle Graham. GO Biological Process: RNA processing | SoyBase | N/A | ISS |
GO:0006508 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteolysis | SoyBase | N/A | ISS |
GO:0007062 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion | SoyBase | N/A | ISS |
GO:0007129 | GO-bp | Annotation by Michelle Graham. GO Biological Process: synapsis | SoyBase | N/A | ISS |
GO:0007131 | GO-bp | Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination | SoyBase | N/A | ISS |
GO:0008284 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation | SoyBase | N/A | ISS |
GO:0009640 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photomorphogenesis | SoyBase | N/A | ISS |
GO:0009793 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy | SoyBase | N/A | ISS |
GO:0009826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth | SoyBase | N/A | ISS |
GO:0009845 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed germination | SoyBase | N/A | ISS |
GO:0009880 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification | SoyBase | N/A | ISS |
GO:0009887 | GO-bp | Annotation by Michelle Graham. GO Biological Process: organ morphogenesis | SoyBase | N/A | ISS |
GO:0009888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: tissue development | SoyBase | N/A | ISS |
GO:0009909 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of flower development | SoyBase | N/A | ISS |
GO:0009933 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meristem structural organization | SoyBase | N/A | ISS |
GO:0009960 | GO-bp | Annotation by Michelle Graham. GO Biological Process: endosperm development | SoyBase | N/A | ISS |
GO:0010072 | GO-bp | Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification | SoyBase | N/A | ISS |
GO:0010090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis | SoyBase | N/A | ISS |
GO:0010162 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed dormancy process | SoyBase | N/A | ISS |
GO:0010182 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway | SoyBase | N/A | ISS |
GO:0010228 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem | SoyBase | N/A | ISS |
GO:0010332 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to gamma radiation | SoyBase | N/A | ISS |
GO:0010389 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle | SoyBase | N/A | ISS |
GO:0010431 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed maturation | SoyBase | N/A | ISS |
GO:0010564 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process | SoyBase | N/A | ISS |
GO:0010638 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization | SoyBase | N/A | ISS |
GO:0016567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein ubiquitination | SoyBase | N/A | ISS |
GO:0016572 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone phosphorylation | SoyBase | N/A | ISS |
GO:0019915 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipid storage | SoyBase | N/A | ISS |
GO:0022402 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell cycle process | SoyBase | N/A | ISS |
GO:0031048 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA | SoyBase | N/A | ISS |
GO:0032204 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance | SoyBase | N/A | ISS |
GO:0032504 | GO-bp | Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction | SoyBase | N/A | ISS |
GO:0033044 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization | SoyBase | N/A | ISS |
GO:0042023 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication | SoyBase | N/A | ISS |
GO:0042138 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation | SoyBase | N/A | ISS |
GO:0043247 | GO-bp | Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage | SoyBase | N/A | ISS |
GO:0045132 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation | SoyBase | N/A | ISS |
GO:0045595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation | SoyBase | N/A | ISS |
GO:0045876 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of sister chromatid cohesion | SoyBase | N/A | ISS |
GO:0045893 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
GO:0048366 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf development | SoyBase | N/A | ISS |
GO:0048825 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cotyledon development | SoyBase | N/A | ISS |
GO:0050826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to freezing | SoyBase | N/A | ISS |
GO:0051225 | GO-bp | Annotation by Michelle Graham. GO Biological Process: spindle assembly | SoyBase | N/A | ISS |
GO:0051276 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromosome organization | SoyBase | N/A | ISS |
GO:0051301 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell division | SoyBase | N/A | ISS |
GO:0051304 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromosome separation | SoyBase | N/A | ISS |
GO:0051307 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meiotic chromosome separation | SoyBase | N/A | ISS |
GO:0051322 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anaphase | SoyBase | N/A | ISS |
GO:0051567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation | SoyBase | N/A | ISS |
GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
GO:0008233 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: peptidase activity | SoyBase | N/A | ISS |
UniRef100_G7IK10 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Separin n=1 Tax=Medicago truncatula RepID=G7IK10_MEDTR | SoyBase | E_val: 2.00E-118 | ISS |
UniRef100_UPI000233B473 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233B473 related cluster n=1 Tax=unknown RepID=UPI000233B473 | SoyBase | E_val: 0 | ISS |
Glyma15g20935 not represented in the dataset |
Glyma15g20935 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma15g20935.1 sequence type=CDS gene model=Glyma15g20935 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high GCGAGTCCCTCGGAATCCTCCCTCATCTCCAAGCTTCAGTCCTCCGATTCCCCCGACATCCATGCCCTGGTCTCTGATTACCTCCATCCCCTGTCAGATCTCAAGCCAACCAAAAAATCCAACCCCGACCAAACCCTAATTCGCTCACTCGCCAAGTGTTTTCTCTCCTTCCTCAACGCCTCCTTATCCATCCTCCCAAAATGGTTCCTTGAGGTCTCCAAGTCTAACAACGTCGTCTCCCTCCTCGAGTTACTCCGTGTTTACAAGATCTGCCTCGATTGCTTGGACGTTGTCGCTTCTCAATTGGGTTCTAAGCCCTTCTTCGTCGAGTTCCAACGACTTCGCCTGATTCACTGCCTCGAGTCATGTGGCCTATTTGACGAAGCCCAACTTGAGGGTTTAGGGGTTTTAGAGAAGCCTCCACCCGCCAAGTGGAAGGGTAAGCTTCTCCCTGAAATAGACAAGGGCAGTGGAGAGGGTAAAGAATTGTGCTCTTTGGTCGTTGATATTGTTGTGAGCCTCCTGAGGTGTGCAACCGCGGGTTTGGCTAAAAAGGATGCCCATTTCAGGAAGGTGCTTTTGTTGGTGGAGGAAGTAAGCCCTTGGCTTAGATTGGATTCCAATTCGTATGAGAAGTTGCACAAGATGTTAGTAACTCATTTGGGCAAGTGCACTTTAAATTTATTGGGGAGTACGCCATTTCCAGATAGATACTTGGTGACCTTGTTTTGGTGTACAACGTTGACTGAATATGTGAAATCTCCCATCAAAGATCAAGTCTACAAGATTGCCCTCAGGGTATGCTCATTATTGTTTGCACTGAGGGATAATAACTCCTTGTATATCATGGATATACTAGAATCCATAGTTCGCGAGTGCAAGGTTGAGGAGGAAAACACAGGAACCAACTTTGTTGAACTTGTATATTACTGTGCAAATAAATGTCAAACTGCAAATGAAAGTTTTTGTAGTACATTTGCAGCATATTTGAACAAAATAGCAGAACATTTCAAACAAGTTATGACACCCATAAATTCAATACTGAGGCTTTATGCTGCTGGATTGCTCCTTGTTTGTTGTAATTTGAGGTCCAGAGCTAGAGATCTAGCATCCTCTGGTAGTGCAAAATTTGAGTGTTTGCTTGGGACTTTACTAGAAAACAAGAAAATACTACAGCGTTTCGGATCTTGA
>Glyma15g20935.1 sequence type=predicted peptide gene model=Glyma15g20935 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ASPSESSLISKLQSSDSPDIHALVSDYLHPLSDLKPTKKSNPDQTLIRSLAKCFLSFLNASLSILPKWFLEVSKSNNVVSLLELLRVYKICLDCLDVVASQLGSKPFFVEFQRLRLIHCLESCGLFDEAQLEGLGVLEKPPPAKWKGKLLPEIDKGSGEGKELCSLVVDIVVSLLRCATAGLAKKDAHFRKVLLLVEEVSPWLRLDSNSYEKLHKMLVTHLGKCTLNLLGSTPFPDRYLVTLFWCTTLTEYVKSPIKDQVYKIALRVCSLLFALRDNNSLYIMDILESIVRECKVEEENTGTNFVELVYYCANKCQTANESFCSTFAAYLNKIAEHFKQVMTPINSILRLYAAGLLLVCCNLRSRARDLASSGSAKFECLLGTLLENKKILQRFGS*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||