SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g19970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g19970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g19970

Feature Type:gene_model
Chromosome:Gm15
Start:17483188
stop:17486847
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G20720AT Annotation by Michelle Graham. TAIR10: chaperonin 20 | chr5:7015015-7016354 FORWARD LENGTH=253 SoyBaseE_val: 2.00E-133ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:1901671GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of superoxide dismutase activity SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005516GO-mf Annotation by Michelle Graham. GO Molecular Function: calmodulin binding SoyBaseN/AISS
KOG1641 KOG Mitochondrial chaperonin JGI ISS
PTHR10772Panther GROES CHAPERONIN JGI ISS
PTHR10772:SF0Panther 10 KDA HEAT SHOCK PROTEIN JGI ISS
PF00166PFAM Chaperonin 10 Kd subunit JGI ISS
UniRef100_B9RR63UniRef Annotation by Michelle Graham. Most informative UniRef hit: Groes chaperonin, putative n=1 Tax=Ricinus communis RepID=B9RR63_RICCO SoyBaseE_val: 1.00E-143ISS
UniRef100_C6TNA3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TNA3_SOYBN SoyBaseE_val: 2.00E-178ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g19970 not represented in the dataset

Glyma15g19970 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g08340 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g180900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g19970.1   sequence type=CDS   gene model=Glyma15g19970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAGCGCTCAGCTCACAGCAATAGCGTCATCGATCTCTACGGCGTCGTTTGAAGGGCTTCGACCTTCCGCTGTTCAGTTTGCTTCCACGGGCAGAATTAGAATTGGCAATCTCTCCCAAAGGTCCTTCCGGGGCTTGGTTGTCAAAGCCGCCACCGTTGTTGCCCCCAAATACACTGCGATAAAGCCTCTGGGAGATAGAGTGCTAATAAAAATTAAGGAAGCAGAGGAGAAAACTGAGGGTGGGATTTTGCTTCCATCAACTGCTCAAACGAAGCCTCAAGGGGGTGAGGTGGTTGCTGTTGGGGAAGGAAAGACAGTTGGGAAGAACAATGTAGAGATTAGTGTGAAGACTGGTGCACAAGTTGTGTATTCGAAGTATGCAGGTACTGAGGTGGACTTCAATGGTACAAAGCATCTTATTGTGAAGGATGATGACATTGTTGGTATCCTCGAAACTGATGACATCAAGGATCTTAAACCCTTGAATGATAGAGTCCTCATAAAGGTTGCTGAAGCTGAGGAAAAAACCTCTGGCGGTTTGTTGCTTACAGAGGCAACCAAGGACAAACCTTCGATTGGAACAGTGATAGCTGTTGGGCCGGGGCATCTGGACGAGGAAGGCAACAGAAAACCGTTGTCCGTGACTCCGGGGAACACAGTTTTGTACTCCAAATATGCTGGAAATGACTTCAAGGGCAAAGATGGTTCTGACTATATTACCTTGAGAGTCTCAGATGTCATGGCTGTTCTCTCCTAG

>Glyma15g19970.1   sequence type=predicted peptide   gene model=Glyma15g19970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASAQLTAIASSISTASFEGLRPSAVQFASTGRIRIGNLSQRSFRGLVVKAATVVAPKYTAIKPLGDRVLIKIKEAEEKTEGGILLPSTAQTKPQGGEVVAVGEGKTVGKNNVEISVKTGAQVVYSKYAGTEVDFNGTKHLIVKDDDIVGILETDDIKDLKPLNDRVLIKVAEAEEKTSGGLLLTEATKDKPSIGTVIAVGPGHLDEEGNRKPLSVTPGNTVLYSKYAGNDFKGKDGSDYITLRVSDVMAVLS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo