SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g19221): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g19221): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g19221

Feature Type:gene_model
Chromosome:Gm15
Start:16379455
stop:16380514
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g19221
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G25440AT Annotation by Michelle Graham. TAIR10: zinc finger WD40 repeat protein 1 | chr4:13007107-13009381 REVERSE LENGTH=430 SoyBaseE_val: 2.00E-18ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
UniRef100_G7KS64UniRef Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger CCCH domain-containing protein n=1 Tax=Medicago truncatula RepID=G7KS64_MEDTR SoyBaseE_val: 2.00E-23ISS
UniRef100_UPI000233AD24UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233AD24 related cluster n=1 Tax=unknown RepID=UPI000233AD24 SoyBaseE_val: 3.00E-96ISS

Expression Patterns of Glyma15g19221
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g19221 not represented in the dataset
Glyma15g19221 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g19221 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma15g19221
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g19221
>Glyma15g19221.1   sequence type=CDS   gene model=Glyma15g19221   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATACAAAGTTTGCACGAAGGACTGAGCGCATTGGTAGAACAACATGCTCTTATTGGAGAGCTGGAAAATGTAACAGAAATCCATGCAGATTTGTGCACATAGAGACACCATCTCCACCTGCTGCTTGTGGTTATGGCAATACTGCATATAGCTACGGAAAAAAGCCCCATTCCTCCTCTGAGAATACCCCGAAATATGGTTCAAAGAAAGCATTGCTTAGAGATAATGGAGATAGAGGAGATGCAACAAGGGTTGCTAAGGCTTTCAAGAAATCATCACCAAGGATATGTAAATACTGGATCAACAACAATTGTGTACATGGTGAACAATGCCTGTATCTGCATTCATGGTTTCGTGGTGATGGGTTTTCCACAGTAACGAAACTTCAAGAACATAAGAAGGTACTTGACTCTTGA
Predicted protein sequences of Glyma15g19221
>Glyma15g19221.1   sequence type=predicted peptide   gene model=Glyma15g19221   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDTKFARRTERIGRTTCSYWRAGKCNRNPCRFVHIETPSPPAACGYGNTAYSYGKKPHSSSENTPKYGSKKALLRDNGDRGDATRVAKAFKKSSPRICKYWINNNCVHGEQCLYLHSWFRGDGFSTVTKLQEHKKVLDS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo