SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g19090

Feature Type:gene_model
Chromosome:Gm15
Start:16104703
stop:16107425
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g19090
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G06510AT Annotation by Michelle Graham. TAIR10: replication protein A 1A | chr2:2585215-2587601 FORWARD LENGTH=640 SoyBaseE_val: 0ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0007141GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis I SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0032504GO-bp Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048232GO-bp Annotation by Michelle Graham. GO Biological Process: male gamete generation SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051026GO-bp Annotation by Michelle Graham. GO Biological Process: chiasma assembly SoyBaseN/AISS
GO:0000790GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear chromatin SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
PTHR23273Panther REPLICATION FACTOR A 1, RFA1 JGI ISS
PF01336PFAM OB-fold nucleic acid binding domain JGI ISS
PF04057PFAM Replication factor-A protein 1, N-terminal domain JGI ISS
PF08646PFAM Replication factor-A C terminal domain JGI ISS
UniRef100_I1MHC1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MHC1_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q6WG36UniRef Annotation by Michelle Graham. Most informative UniRef hit: RPA 70kDa subunit n=1 Tax=Pisum sativum RepID=Q6WG36_PEA SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g19090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g19090 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g174100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g19090
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g19090
>Glyma15g19090.1   sequence type=CDS   gene model=Glyma15g19090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGCTGAATCTCACGGCAAACGCGATCCCGGCGATAATCGGTGGCGACGTGAACGCGAAACCGCTGGTTCAGGTTCTGGACGTGGCGCTAGTCTCCAATAGCAACAACTCGCAGCAGCAGCAGCAGAGGTACCGTCTTCTGCTATCCGACGCCGTTTTCTCTCACCACGCGATGCTCGCAACTCAGCTCAACGACCGAGTCCGAACCGGTCGAGTTCAGAAGGGTTCGGTTGTTCAGCTTCTCGATTATATATGCACTCCTCTCAAGAACCGCAAGATTATTGTGATTCTAAACATGGAAACTATAATGGATGAGTTTGAGATCATTGGGAATCCAAAGCCATATATGGATTCTGATATACCAACAGTGAGAGCTTCAGATTCAGCTTCAGCTGATAGCACTGTTGAGAATTTGCCCAGGAGTTATAATAGTAATAATAGTTCTGCTGGTCAAAATGCAAGTCACAATAACACGCAGAATTTCAGGCCAACTATTCAACCTCCATACCAACCACCTCCACTTTACAAAGGCCGTGGGCCAGTTGTGAAAAATGAGGCACCAGCACGCATCATTCCTATAGCTGCTTTAAATCCGTATCAGGGTCGGTGGGCTATCAAGGCAAGGGTAACTGCTAAAGGGGATCTGCGCCGCTATAATAATGCTCGTGGTGATGGGAAAGTCTTCTCATTTGATCTCCTTGATTCTGATGGAGGTGAAATACGAGTAACATGCTTTAATGCTGTTGTTGACCGCTTCTATAATGTAATTGAGGTTGGTAAAGTTTACATGATATCCAAAGGTAGCTTGAAACCTGCTCAGAAGAATTTCAACCATTTGAAGAATGAATGGGAAATTTTGTTGGAATCATCTTCAATGGTTGAGCTCTGCCCAGACGAGGATGGTTCTATACCTAGACAGCAGTTCTCCTTCAGGCCTATTAGTGACATTGAGAATGTTGACAATAACTCCATCCTTGATGTTATTGGGGTAGTGACATCTGTGAATCCTTCAGTTCCCATCTTGAGGAAGAATGGAATGGAAACCCAGAGAAGAATTTTGAGTCTGAAGGACAGTTCTGGCAGTAGTGTTGAACTTACACTGTGGGGCGAATTCTGCAACAGGGAAGGACAACAGCTTCAAGACATGGTGGATGCTGGATTTTTCCCAATTTTAGCAGTCAAAACTGGGAAGGTGAATGATTTTAGTGGAAAGTCGATAGGTTCTATTTCTACCACGCAGCTTTTCATAAATCCTGATTTTCCTGAGGCTCATAGCTTAAGAGAATGGTTTGAACTGGTAGGAAAAGATTCTGCCTCCTTATCGATTTCTAAGGACATTATTCCCGGAGCATTGAAGAATGAGGTCCGCAAAACTGTGTCTCAAATCAAGGATGAAGGTCTAGGGCGGTCAGACAAGCCAGACTGGATAACAGTAAGGGCTGCTATATTATTCATCAAGACAGATACATTTTGTTACACAGCTTGCCCTCTGATGATTGGAGATCGACAGTGCAATAAGAAAGTGACTAGGCTAGGAAACACAAGGTGGCAATGTGATAGATGCAACCAAGAATTTGAGGAGTGTGATTACCGATACCTTCTCCAAGTTCAAATTCTTGATGGCACAGGATTAGCTTGGGTAACTGCTTTCCAAGAAGCAGGGGAAGAGATTATGGATTACTCAGCAAAGGATCTGTACTTTTTGAAACATGAAGAGCAGGATGATGAGAAGTTTGGAGAAATAATCAAGAGCCGACTCTTCAACCAGTTCATGTTTAGGCTGAAAATCAAAGAGGAATTATATGGCGATGAACAGAAGGTGAAGATTACTGTGGTCAAGGCTGATAAGGTGAACTACTCTTCAGAGAGTAGATACATGCTTGATACGATTTCCAAGTTTTGTAGGCAGTAA
Predicted protein sequences of Glyma15g19090
>Glyma15g19090.1   sequence type=predicted peptide   gene model=Glyma15g19090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLNLTANAIPAIIGGDVNAKPLVQVLDVALVSNSNNSQQQQQRYRLLLSDAVFSHHAMLATQLNDRVRTGRVQKGSVVQLLDYICTPLKNRKIIVILNMETIMDEFEIIGNPKPYMDSDIPTVRASDSASADSTVENLPRSYNSNNSSAGQNASHNNTQNFRPTIQPPYQPPPLYKGRGPVVKNEAPARIIPIAALNPYQGRWAIKARVTAKGDLRRYNNARGDGKVFSFDLLDSDGGEIRVTCFNAVVDRFYNVIEVGKVYMISKGSLKPAQKNFNHLKNEWEILLESSSMVELCPDEDGSIPRQQFSFRPISDIENVDNNSILDVIGVVTSVNPSVPILRKNGMETQRRILSLKDSSGSSVELTLWGEFCNREGQQLQDMVDAGFFPILAVKTGKVNDFSGKSIGSISTTQLFINPDFPEAHSLREWFELVGKDSASLSISKDIIPGALKNEVRKTVSQIKDEGLGRSDKPDWITVRAAILFIKTDTFCYTACPLMIGDRQCNKKVTRLGNTRWQCDRCNQEFEECDYRYLLQVQILDGTGLAWVTAFQEAGEEIMDYSAKDLYFLKHEEQDDEKFGEIIKSRLFNQFMFRLKIKEELYGDEQKVKITVVKADKVNYSSESRYMLDTISKFCRQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo