Glyma15g18241 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g18241): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g18241): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g18241

Feature Type:	gene_model
Chromosome:	Gm15
Start:	14897316
stop:	14901037
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g18241

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G57090	AT	Annotation by Michelle Graham. TAIR10: Auxin efflux carrier family protein \| chr5:23100765-23104456 FORWARD LENGTH=647	SoyBase	E_val: 2.00E-105	ISS
GO:0008361	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cell size	SoyBase	N/A	ISS
GO:0009637	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to blue light	SoyBase	N/A	ISS
GO:0009640	GO-bp	Annotation by Michelle Graham. GO Biological Process: photomorphogenesis	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009749	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus	SoyBase	N/A	ISS
GO:0009926	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin polar transport	SoyBase	N/A	ISS
GO:0009958	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive gravitropism	SoyBase	N/A	ISS
GO:0043481	GO-bp	Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light	SoyBase	N/A	ISS
GO:0046685	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0048443	GO-bp	Annotation by Michelle Graham. GO Biological Process: stamen development	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0000323	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: lytic vacuole	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009925	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: basal plasma membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0009672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: auxin:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0010329	GO-mf	Annotation by Michelle Graham. GO Molecular Function: auxin efflux transmembrane transporter activity	SoyBase	N/A	ISS
PF03547	PFAM	Membrane transport protein	JGI		ISS
UniRef100_B9SNY5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Auxin efflux carrier component, putative (Fragment) n=1 Tax=Ricinus communis RepID=B9SNY5_RICCO	SoyBase	E_val: 3.00E-121	ISS
UniRef100_UPI000233B611	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B611 related cluster n=1 Tax=unknown RepID=UPI000233B611	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma15g18241

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g18241 not represented in the dataset	Glyma15g18241 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g18241 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g168100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g18241

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g18241

Limit To All Plant Sequences

>Glyma15g18241.1   sequence type=CDS   gene model=Glyma15g18241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATCAAAGGAAAAGACATTTACGAAGTTGTGGCAGCACTTGTGCCTCTCTACGTGGCTTTGATCTTAGGCTATGGCTCCGTCCATTGGTGGAAGATATTCACCCCAGAACATACCCTTCCATTCCATTTCATATCATCCAACAACCCTTACACCATGAACTTCAGGTTCTTAGCTGCGGACTCACTTCAAAAGTTTGTGATTTTGGTCGCACTTTTCCTATGCACCACTTTCACGAAGTGGGGTAGCATTGACTGGTCCATCACACTATTCTCACTCTCCACTCTCCCCAAACATTCATCATGGGGAGGTGCCAAGCTTTTCATTTCAAATCAATTCCCTAAGACTGCAGATGCAATTTCAACCCTAAGGGTTGATTCAAACGTTGGCTCTCTCAATGGTAGAGAGCCATTGCAAACTGATGCAGAAATTGCAGAAGATGGACAACTTCATGTGATAGTGAGGAACATGTCACGTTCCACGTCGATGGTTTCACCAAGGACATCAAATCTTACCGGGGTTGAGATATTTTCGGTGACTTCTTCTAGAGAAGTACCAAGCCAAAGAGCTTCAAGTGGTGCTTCTGGTTTTGAAGAATGGATGATGTTGAATAACAACAAGCATGAGAAGAGGTTTTCAAGGAGCAAGAATACTGTTAGTGATGATTTGGTAATTTCTCCGTCTCCAAAACCAATAAAGTTTTTAGGGTCTAACAGTGGTGGCCAAAGAAACAAAGACATGAAAAACGGTGCAACTATTAACAAGGATAAGGGGTTACACGTGTTTGTTTGGAGCTCAACTTCGTCGCCAACTTCTGATGTTAATTATACGAAACATGGAGTGAATAGAGTTGGTTCCGCTGACTTTGGCACCATTGAATCTTCCAAGGTTGTTGATTTATACCACACGAAACTGCTTCCTCAAAAGATGATGGGTGTCTGCCCATATTTTGCATACTTTAATGTTATACTAGACGTAGACATAACACTATTGAGTTGCACTGATTTAATTGAATATTTAAAATATCATTTTAATATGAATCTAATAAGAAACCCTAATACCTGGGCGAGTGTTTTGGGCCTCGTTTGGTGGAACATCAAGACGCCTACTATTGTAGCAAAATCCATTAAAATAATGTCTAATACGGGGCTGGGAATGGCAATGTTCACTCTAGCAATGTTGCTGGGTGCACCTAGCATGTCCCCAATTTCATTAGTAACTGGGTTCTTGGTTGGTCCAACAATGATTCTTGCAACCTCCAAAGTCATGGGTATCCATGGAGTTCATTTACATATTACAATTGTTCAGAACATAATACTCCACACGGACATACTCAACACAGCGGCTATCTTTGGGATGGTGGTTGCATTGCCCATAACAATAATCTACTCTGCGCTTCTTGAATTGTAA

Predicted protein sequences of Glyma15g18241

Limit To All Plant Sequences

>Glyma15g18241.1   sequence type=predicted peptide   gene model=Glyma15g18241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIKGKDIYEVVAALVPLYVALILGYGSVHWWKIFTPEHTLPFHFISSNNPYTMNFRFLAADSLQKFVILVALFLCTTFTKWGSIDWSITLFSLSTLPKHSSWGGAKLFISNQFPKTADAISTLRVDSNVGSLNGREPLQTDAEIAEDGQLHVIVRNMSRSTSMVSPRTSNLTGVEIFSVTSSREVPSQRASSGASGFEEWMMLNNNKHEKRFSRSKNTVSDDLVISPSPKPIKFLGSNSGGQRNKDMKNGATINKDKGLHVFVWSSTSSPTSDVNYTKHGVNRVGSADFGTIESSKVVDLYHTKLLPQKMMGVCPYFAYFNVILDVDITLLSCTDLIEYLKYHFNMNLIRNPNTWASVLGLVWWNIKTPTIVAKSIKIMSNTGLGMAMFTLAMLLGAPSMSPISLVTGFLVGPTMILATSKVMGIHGVHLHITIVQNIILHTDILNTAAIFGMVVALPITIIYSALLEL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain