SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g18241

Feature Type:gene_model
Chromosome:Gm15
Start:14897316
stop:14901037
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g18241
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G57090AT Annotation by Michelle Graham. TAIR10: Auxin efflux carrier family protein | chr5:23100765-23104456 FORWARD LENGTH=647 SoyBaseE_val: 2.00E-105ISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009958GO-bp Annotation by Michelle Graham. GO Biological Process: positive gravitropism SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0046685GO-bp Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0000323GO-cc Annotation by Michelle Graham. GO Cellular Compartment: lytic vacuole SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009925GO-cc Annotation by Michelle Graham. GO Cellular Compartment: basal plasma membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0009672GO-mf Annotation by Michelle Graham. GO Molecular Function: auxin:hydrogen symporter activity SoyBaseN/AISS
GO:0010329GO-mf Annotation by Michelle Graham. GO Molecular Function: auxin efflux transmembrane transporter activity SoyBaseN/AISS
PF03547PFAM Membrane transport protein JGI ISS
UniRef100_B9SNY5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Auxin efflux carrier component, putative (Fragment) n=1 Tax=Ricinus communis RepID=B9SNY5_RICCO SoyBaseE_val: 3.00E-121ISS
UniRef100_UPI000233B611UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B611 related cluster n=1 Tax=unknown RepID=UPI000233B611 SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g18241
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g18241 not represented in the dataset
Glyma15g18241 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g18241 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g168100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g18241
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g18241
>Glyma15g18241.1   sequence type=CDS   gene model=Glyma15g18241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATCAAAGGAAAAGACATTTACGAAGTTGTGGCAGCACTTGTGCCTCTCTACGTGGCTTTGATCTTAGGCTATGGCTCCGTCCATTGGTGGAAGATATTCACCCCAGAACATACCCTTCCATTCCATTTCATATCATCCAACAACCCTTACACCATGAACTTCAGGTTCTTAGCTGCGGACTCACTTCAAAAGTTTGTGATTTTGGTCGCACTTTTCCTATGCACCACTTTCACGAAGTGGGGTAGCATTGACTGGTCCATCACACTATTCTCACTCTCCACTCTCCCCAAACATTCATCATGGGGAGGTGCCAAGCTTTTCATTTCAAATCAATTCCCTAAGACTGCAGATGCAATTTCAACCCTAAGGGTTGATTCAAACGTTGGCTCTCTCAATGGTAGAGAGCCATTGCAAACTGATGCAGAAATTGCAGAAGATGGACAACTTCATGTGATAGTGAGGAACATGTCACGTTCCACGTCGATGGTTTCACCAAGGACATCAAATCTTACCGGGGTTGAGATATTTTCGGTGACTTCTTCTAGAGAAGTACCAAGCCAAAGAGCTTCAAGTGGTGCTTCTGGTTTTGAAGAATGGATGATGTTGAATAACAACAAGCATGAGAAGAGGTTTTCAAGGAGCAAGAATACTGTTAGTGATGATTTGGTAATTTCTCCGTCTCCAAAACCAATAAAGTTTTTAGGGTCTAACAGTGGTGGCCAAAGAAACAAAGACATGAAAAACGGTGCAACTATTAACAAGGATAAGGGGTTACACGTGTTTGTTTGGAGCTCAACTTCGTCGCCAACTTCTGATGTTAATTATACGAAACATGGAGTGAATAGAGTTGGTTCCGCTGACTTTGGCACCATTGAATCTTCCAAGGTTGTTGATTTATACCACACGAAACTGCTTCCTCAAAAGATGATGGGTGTCTGCCCATATTTTGCATACTTTAATGTTATACTAGACGTAGACATAACACTATTGAGTTGCACTGATTTAATTGAATATTTAAAATATCATTTTAATATGAATCTAATAAGAAACCCTAATACCTGGGCGAGTGTTTTGGGCCTCGTTTGGTGGAACATCAAGACGCCTACTATTGTAGCAAAATCCATTAAAATAATGTCTAATACGGGGCTGGGAATGGCAATGTTCACTCTAGCAATGTTGCTGGGTGCACCTAGCATGTCCCCAATTTCATTAGTAACTGGGTTCTTGGTTGGTCCAACAATGATTCTTGCAACCTCCAAAGTCATGGGTATCCATGGAGTTCATTTACATATTACAATTGTTCAGAACATAATACTCCACACGGACATACTCAACACAGCGGCTATCTTTGGGATGGTGGTTGCATTGCCCATAACAATAATCTACTCTGCGCTTCTTGAATTGTAA
Predicted protein sequences of Glyma15g18241
>Glyma15g18241.1   sequence type=predicted peptide   gene model=Glyma15g18241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIKGKDIYEVVAALVPLYVALILGYGSVHWWKIFTPEHTLPFHFISSNNPYTMNFRFLAADSLQKFVILVALFLCTTFTKWGSIDWSITLFSLSTLPKHSSWGGAKLFISNQFPKTADAISTLRVDSNVGSLNGREPLQTDAEIAEDGQLHVIVRNMSRSTSMVSPRTSNLTGVEIFSVTSSREVPSQRASSGASGFEEWMMLNNNKHEKRFSRSKNTVSDDLVISPSPKPIKFLGSNSGGQRNKDMKNGATINKDKGLHVFVWSSTSSPTSDVNYTKHGVNRVGSADFGTIESSKVVDLYHTKLLPQKMMGVCPYFAYFNVILDVDITLLSCTDLIEYLKYHFNMNLIRNPNTWASVLGLVWWNIKTPTIVAKSIKIMSNTGLGMAMFTLAMLLGAPSMSPISLVTGFLVGPTMILATSKVMGIHGVHLHITIVQNIILHTDILNTAAIFGMVVALPITIIYSALLEL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo