SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g17550

Feature Type:gene_model
Chromosome:Gm15
Start:13950468
stop:13951751
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g17550
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G18969AT Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding transcription factors;transcription regulators (TAIR:AT4G30180.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr2:8229047-8229574 REVERSE LENGTH=175 SoyBaseE_val: 2.00E-27ISS
UniRef100_D7MC79UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor/ transcription regulator n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MC79_ARALL SoyBaseE_val: 1.00E-20ISS
UniRef100_I1MGZ4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MGZ4_SOYBN SoyBaseE_val: 1.00E-149ISS

Expression Patterns of Glyma15g17550
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g17550
ParalogEvidenceComments
Glyma09g06290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g17550 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g162800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g17550
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g17550
>Glyma15g17550.1   sequence type=CDS   gene model=Glyma15g17550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGTCAACCTGCTAAACGCAGACGTGTGTACTCTCTTGAACCCAACAAAGTGGAACAAGCAGCATTTGCCAGAAACTACATGAACTATTTGGTGCCAGCATTGATGAAGATCAAGGAAAGAAGCACTTCATCAGATCAACATAGTGGCTATTGTGATGACAATATTCAGAATGTTGTCAAGTATGAAGTGGACATGGCAATGGTGCACTCAGCCCAAGGTTTTGCATGGAGTAATGCTCTAAGTGTGAAGCTTCAAAGAGATAGAGTCAATGTAGATTGTGACACCACTAGCTTTGGTGAAGGTTCATCATCATCAAGGGTTTGTGGCCAAAATTGTGAAATGGTGCCGTTGGATAATTTCCCTTCAAACCCTAGTTTGAAATCTAATAACAAGTGCAAGGAAATGCCTGAAATGAAAAGGGGTTTGAGAGAAGATGATGATGGTGATGAAGATGAAGTCATCAATGGTCAATTGAAGAGCCTAAGAAGGTTGATGCCGGGTGGAGAAGAGATGTGTAGTGAACAAATGGTGACAGAACTACAAAGCTATGTAAGCTGTTTGCAAATGCAGGTGAACATTCTTCGGTGCCTCGCGGAGACACATTGA
Predicted protein sequences of Glyma15g17550
>Glyma15g17550.1   sequence type=predicted peptide   gene model=Glyma15g17550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGQPAKRRRVYSLEPNKVEQAAFARNYMNYLVPALMKIKERSTSSDQHSGYCDDNIQNVVKYEVDMAMVHSAQGFAWSNALSVKLQRDRVNVDCDTTSFGEGSSSSRVCGQNCEMVPLDNFPSNPSLKSNNKCKEMPEMKRGLREDDDGDEDEVINGQLKSLRRLMPGGEEMCSEQMVTELQSYVSCLQMQVNILRCLAETH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo