Glyma15g16151 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g16151): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g16151): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g16151

Feature Type:	gene_model
Chromosome:	Gm15
Start:	12456388
stop:	12457230
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g16151

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G06810	AT	Annotation by Michelle Graham. TAIR10: acyl-CoA dehydrogenase-related \| chr3:2146534-2150654 FORWARD LENGTH=824	SoyBase	E_val: 6.00E-52	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009610	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to symbiotic fungus	SoyBase	N/A	ISS
GO:0048767	GO-bp	Annotation by Michelle Graham. GO Biological Process: root hair elongation	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0003995	GO-mf	Annotation by Michelle Graham. GO Molecular Function: acyl-CoA dehydrogenase activity	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0016627	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
GO:0050660	GO-mf	Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding	SoyBase	N/A	ISS
PTHR10909	Panther	ELECTRON TRANSPORT OXIDOREDUCTASE	JGI		ISS
PTHR10909:SF147	Panther	OS07G0675000 PROTEIN	JGI		ISS
PF00441	PFAM	Acyl-CoA dehydrogenase, C-terminal domain	JGI		ISS
UniRef100_I1MGN7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MGN7_SOYBN	SoyBase	E_val: 7.00E-58	ISS
UniRef100_Q9M7Y7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Acetyl-coA dehydrogenase, putative n=1 Tax=Arabidopsis thaliana RepID=Q9M7Y7_ARATH	SoyBase	E_val: 8.00E-50	ISS

Expression Patterns of Glyma15g16151

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g16151 not represented in the dataset	Glyma15g16151 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g16151 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma15g16151

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g16151

Limit To All Plant Sequences

>Glyma15g16151.1   sequence type=CDS   gene model=Glyma15g16151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAAGCTTTTTGTTCTTCAGTGCCGGATAGAGCTAGAGAGCACCAGATTGTTAGTGTTGGAAGCAGCTGACCAACTTGACAGGCATGGCAACAAAAAAGCTCGAGGGATATTAGCAATGGCGAAGGTAGCCGCACCAAACATGGCACTGAAGGTGCTTGACATGGCAATACAAGTGCATGGAGCAGCTGGTGTATCATCTGACACAGTCCTGGCACATCTCTGGGCAGCTGCAAGGACACTGAGAATCGCGGATGGTCCAGATGAAGTTCACTTGGGGACCATAGCCAAGTTAGAACTACAGAAAGCCAAACTTTGA

Predicted protein sequences of Glyma15g16151

Limit To All Plant Sequences

>Glyma15g16151.1   sequence type=predicted peptide   gene model=Glyma15g16151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKLFVLQCRIELESTRLLVLEAADQLDRHGNKKARGILAMAKVAAPNMALKVLDMAIQVHGAAGVSSDTVLAHLWAAARTLRIADGPDEVHLGTIAKLELQKAKL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain