SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g15105

Feature Type:gene_model
Chromosome:Gm15
Start:11548096
stop:11552739
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g15105
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G03450AT Annotation by Michelle Graham. TAIR10: RGA-like 2 | chr3:819636-821279 REVERSE LENGTH=547 SoyBaseE_val: 2.00E-29ISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009686GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellin biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009740GO-bp Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009938GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of gibberellic acid mediated signaling pathway SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010187GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of seed germination SoyBaseN/AISS
GO:0010325GO-bp Annotation by Michelle Graham. GO Biological Process: raffinose family oligosaccharide biosynthetic process SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0048444GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ morphogenesis SoyBaseN/AISS
GO:0048608GO-bp Annotation by Michelle Graham. GO Biological Process: reproductive structure development SoyBaseN/AISS
GO:2000033GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed dormancy process SoyBaseN/AISS
GO:2000377GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of reactive oxygen species metabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF03514PFAM GRAS family transcription factor JGI ISS
UniRef100_A2Q2X8UniRef Annotation by Michelle Graham. Most informative UniRef hit: DELLA protein GAI n=1 Tax=Medicago truncatula RepID=A2Q2X8_MEDTR SoyBaseE_val: 6.00E-122ISS
UniRef100_I1L0R7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L0R7_SOYBN SoyBaseE_val: 5.00E-159ISS

Expression Patterns of Glyma15g15105
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g15105 not represented in the dataset
Glyma15g15105 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g15105 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g141300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g15105
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g15105
>Glyma15g15105.1   sequence type=CDS   gene model=Glyma15g15105   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGATTTGTACCATGTCAGTTTCACTACAGATGCCAATTTTAGTTCATCCAACGATATTTTGTGGTGTACTGAGGAACTAAATGAATTGAGAAAGGTTCAATTTTCTAGAGCAGAAGATCATGGAGACTATGGGGGAATTGACCCTCTCTACTCTAACTTTGGGTTCTTCCCAGATGATCCATCCACTAATCACCAAAAGTATCACCAGCAACTGCAACCATCATACCATGATTATGGAAAATTCGATGATAACCTTCAGTTTGACATGCCACACTCAAACTCAACTACTCCTTTAGCCTCACTTGAAATCTTGAACAACTATGGCAAGGGCTTCAAGAGGTTACGCAATGATGATGTGGCTATGGCCACCACAAATGAAGGTATTTGGAGAAAGCTCTCAATTGAAGATGTCATGAGGATTGCAGGAACAAGCCCGGTTAGACGAATTGTTCATTACTTTGCAGAGGCACTTCGCCTGAGGATGGATAGAGCAACAGGAAGAGTTTCATGCAAGGATTTGCAAAAGGGTCCTTCATTTGATCCTCTAGAGGCAGCCAAGGTACTAAACCCCACTGTTGTTGCATTTTATGAAGAACTTCCCTTTTGTCAAATTTCAGTGTTCACAGAAGTTCAAGATATAATAGAAGATGTTGCTGAAGCAAAGAAGATTCATGTTATTGATCTTGAAATCAAAAAGGGAGGGCAGTGGACTATCCTAATGCAAGCCCTTGAGTCAAGGCATGAATGTCCAATTGAGCTTCTGAAGATAACCGCTATAACCGCTGTAGAAAGTGGAACCACTAGATACATAGCTGAGGACACTGGTGAGAGACTAAAGGATTATGCTCAAGGTATGAACAGACCCTTCTCTTTCAACATAGTTATGGTATCAGACATGTTACATCTAAGAGAAGATCTTTTTGAGATTGATCCTGAGGAAACAATTGCTGTTTATTCCCTAGTGATTAGAACCTTGAGTCCTAGTGTGATGGTGGTTGCTGAAATTGAGGCAAACCACAATTCTACATCTTTTGTAAACCGTTTCATTGAGGCTCTTTTCTTCTTCAGTGCATTCTTTGATTGTCTTGAGACTTGCATGAAAAGGGAAGTAGCAGAAAGAAATACTAGAAATCTGAAGGTTGATGTGTGGAGGGCCTTCCTCTCCCGCTTTGGAATGAATGGACATTGCCTTCTTATTGGGTGGAAAGGAACACCGATTAACTCTGTTTCTGTCTGGAAATTTCTTTGA
Predicted protein sequences of Glyma15g15105
>Glyma15g15105.1   sequence type=predicted peptide   gene model=Glyma15g15105   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEDLYHVSFTTDANFSSSNDILWCTEELNELRKVQFSRAEDHGDYGGIDPLYSNFGFFPDDPSTNHQKYHQQLQPSYHDYGKFDDNLQFDMPHSNSTTPLASLEILNNYGKGFKRLRNDDVAMATTNEGIWRKLSIEDVMRIAGTSPVRRIVHYFAEALRLRMDRATGRVSCKDLQKGPSFDPLEAAKVLNPTVVAFYEELPFCQISVFTEVQDIIEDVAEAKKIHVIDLEIKKGGQWTILMQALESRHECPIELLKITAITAVESGTTRYIAEDTGERLKDYAQGMNRPFSFNIVMVSDMLHLREDLFEIDPEETIAVYSLVIRTLSPSVMVVAEIEANHNSTSFVNRFIEALFFFSAFFDCLETCMKREVAERNTRNLKVDVWRAFLSRFGMNGHCLLIGWKGTPINSVSVWKFL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo