Glyma15g14970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g14970

Feature Type:	gene_model
Chromosome:	Gm15
Start:	11407657
stop:	11411191
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g14970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G06610	AT	Annotation by Michelle Graham. TAIR10: DNA-binding enhancer protein-related \| chr3:2060837-2061845 FORWARD LENGTH=115	SoyBase	E_val: 5.00E-53	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG3450	KOG	Huntingtin interacting protein HYPK	JGI		ISS
UniRef100_A2Q2W3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Huntingtin-interacting protein K n=1 Tax=Medicago truncatula RepID=A2Q2W3_MEDTR	SoyBase	E_val: 4.00E-64	ISS
UniRef100_I1MGE4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MGE4_SOYBN	SoyBase	E_val: 3.00E-69	ISS

Expression Patterns of Glyma15g14970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g14970

Paralog	Evidence	Comments
Glyma09g03970	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g14970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g139900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g14970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g14970

Limit To All Plant Sequences

>Glyma15g14970.1   sequence type=CDS   gene model=Glyma15g14970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGTGGAGAGGAAGGATTGGAGATGATGGTGGACTCAAAGGACTTACAGCAACAGAGCAAAGCGTTGGACAAACTCACTGATCACGTCGAGGATCGCCAACTCGATTCCACTCGCGTCCAAGAGGCCATGGCTTCCATCGCTGCTTCTGCCGAAGCTGATCGCAATGCCATGCGCATCAGGGAAAAAGAATTGGCTGCTGTTAAGATAAATGCAGCAGATGTTGATATAATTGCAAATGAACTAGAGTTGGACAAAAAGGTTGCTGAAAGAACTTTGCGTGAGCATAAAGGTGATGCAGTTGCTGCTATTCGGCACTTGCTTCACTAG

Predicted protein sequences of Glyma15g14970

Limit To All Plant Sequences

>Glyma15g14970.1   sequence type=predicted peptide   gene model=Glyma15g14970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGGEEGLEMMVDSKDLQQQSKALDKLTDHVEDRQLDSTRVQEAMASIAASAEADRNAMRIREKELAAVKINAADVDIIANELELDKKVAERTLREHKGDAVAAIRHLLH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain