SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g14350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g14350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g14350

Feature Type:gene_model
Chromosome:Gm15
Start:10814697
stop:10817846
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G12380AT Annotation by Michelle Graham. TAIR10: annexin 8 | chr5:4009223-4010687 FORWARD LENGTH=316 SoyBaseE_val: 8.00E-140ISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0005544GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium-dependent phospholipid binding SoyBaseN/AISS
KOG0819 KOG Annexin JGI ISS
PTHR10502Panther ANNEXIN JGI ISS
PTHR10502:SF10Panther ANNEXIN VII JGI ISS
PF00191PFAM Annexin JGI ISS
UniRef100_B9SM17UniRef Annotation by Michelle Graham. Most informative UniRef hit: Annexin, putative n=1 Tax=Ricinus communis RepID=B9SM17_RICCO SoyBaseE_val: 4.00E-138ISS
UniRef100_I1MG91UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MG91_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g14350 not represented in the dataset

Glyma15g14350 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g03430 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g135400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g14350.1   sequence type=CDS   gene model=Glyma15g14350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACGCTAATTGCTGCAAAACATTCTTCTTCGATTGAAGATGCTGAAAATATCAAGAAAGCGTGCAAAGGATTGGGGACAGATGAGACAGCTCTTATATCTATACTAGCACATCGAAATGTAGCTCAAAGGAAACTTGTGAGGATGGCTTATGAAGAACTTTATCAGGAAGATCTTATCCAACAATTCAAATCTGAACTTTCAGGAAGCTTTGAGAGAGCTATTTGCAATTGGACGATGGATCCAGCTGAAAGAGACGCTGCATTTATTAATGAAGCATTAAAGAAGGAAACACCAGATTACAAAGTAATTGTTGAGATTGTTTGCACTAGAACATCAGAAGAGTTTCTTGCTGCAAAGCGTTCATACCAGTTTCAATACAAGCATTGCCTTGAAGAAGATGTGGCATCCAAAACAATCGGTGATATTCGCAGATTGTTGGTTGCAGTTATAAGTACCTATAGGTATGATGGAGACGAGTTTGATGAGAATCTGGCTCATTTAGAAGCAAACATTCTTCATCAAGTGATCGAAAACAAGGCCTTTAACGACGATGAAATCATAAGAATTTTATGCACAAGAAGTAAGAAGCAGCTATGTGCAACTTTCAGTACCTTTAGAAATGTGTATGGCACGACAATTACCAAGGGATTATCAACAAATCCAAATGATGAATACATGACAGCACTGCGTACTGTCATTCGTTGCATTAAGAACCCTCGTAGATACTTGGCTAAGGTGTTATGCTACGCCTTGAATGAATTGATAGCTGAAGAACATGAATTGAGCCGTGTAATCATCACTCGTGCAGAGAGGGATTTAAATGAAATCAATGACCTTTACTTCAAGAGAAATGGTGTCACACTTGATAGTTCCGTGGCTAAGAAGACATCAGGAAATTACAAGAATTTTCTTCTTGCGTTGTTAGGAAACAATTGA

>Glyma15g14350.1   sequence type=predicted peptide   gene model=Glyma15g14350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATLIAAKHSSSIEDAENIKKACKGLGTDETALISILAHRNVAQRKLVRMAYEELYQEDLIQQFKSELSGSFERAICNWTMDPAERDAAFINEALKKETPDYKVIVEIVCTRTSEEFLAAKRSYQFQYKHCLEEDVASKTIGDIRRLLVAVISTYRYDGDEFDENLAHLEANILHQVIENKAFNDDEIIRILCTRSKKQLCATFSTFRNVYGTTITKGLSTNPNDEYMTALRTVIRCIKNPRRYLAKVLCYALNELIAEEHELSRVIITRAERDLNEINDLYFKRNGVTLDSSVAKKTSGNYKNFLLALLGNN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo