SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g13700

Feature Type:gene_model
Chromosome:Gm15
Start:10304840
stop:10316076
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g13700
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G21160AT Annotation by Michelle Graham. TAIR10: Calcium-dependent ARF-type GTPase activating protein family | chr4:11284694-11286532 FORWARD LENGTH=337 SoyBaseE_val: 0ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006605GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016197GO-bp Annotation by Michelle Graham. GO Biological Process: endosomal transport SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005543GO-mf Annotation by Michelle Graham. GO Molecular Function: phospholipid binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG1030 KOG Predicted Ca2+-dependent phospholipid-binding protein JGI ISS
PTHR23180Panther CENTAURIN/ARF JGI ISS
PTHR23180:SF24Panther CENTAURIN/ARF-RELATED JGI ISS
PF00168PFAM C2 domain JGI ISS
PF01412PFAM Putative GTPase activating protein for Arf JGI ISS
UniRef100_G7IKU9UniRef Annotation by Michelle Graham. Most informative UniRef hit: ZAC n=2 Tax=Medicago truncatula RepID=G7IKU9_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1MG37UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MG37_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g13700
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g13700
ParalogEvidenceComments
Glyma09g02830 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g13700 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g130300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g13700
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g13700
>Glyma15g13700.1   sequence type=CDS   gene model=Glyma15g13700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAACTTGCAAGACCTGCCTCAAGTAGAAGAAAATTGAAAGATTTATTGCTTCAGAGTGATAATCGTCTTTGTGCTGATTGTAATGCTCCAGATCCTAAATGGGCGTCTGCCAACATTGGAGTTTTTATATGCTTAAAATGTTGTGGTGTGCACAGAAGCCTTGGTACTCATATATCAAAGGTTTTGTCTGTGACATTGGATGATTGGTCAGAGGATGAAATAGATGCAATGATGGAAGTTGGGGGAAATGCTTCTGCTAATTCAATTTATGAAGCTTATATTCCTGAAGGATATACGAAACCTGGACCAGATGCTGGTCATGAGCAGCGTTCAAAATTCATACGGTCAAAATATGAATTACAAGAATTTCTGAAACCGAGTTTGCGCATTGTGTCTGGAAAAAGCAGTCTACAATCAAGTTCTGCAAAAAGTAGTTTTATGGACAGTTTTAAAAGTACTGGTAGTTCACAGAGAATGGAAGGTATGGTGGAATTTATTGGAATGTTGAAGGTGAAAGTGATTAAAGGAACAAATTTAGCTATCAGAGATATAAAGTCAAGTGATCCGTATGTTGTTTTGAGCCTTGGCCAGCAGACTGTCCAGACAACTATAATAAGGAGTAACTTGAATCCAGTCTGGAATGAGGAATACATGCTGTCTGTTCCCGAGCATTATGGACAGATGAAATTGAAAGTATTTGATCATGACACATTTTCTGCTGATGATATAATGGGAGAAGCAGACATTGATCTTCAGTCTCTGATAACATCTGCTATGGCATTTGGAGATGCTGGAATGTTTGGTAATATGCAGATAGGAAAATGGTTAAAATCAGATGACAATGCCCTTATTGAGGATAGCACAGTCAATATTGTTGATGGTAAGGTCAAACAAATGATGTCACTCAAGCTCCAGGATGTTGAATCTGGAGAATTAGATCTGGAACTCGAGTGGATTCCTCTTGAGCAATAG
Predicted protein sequences of Glyma15g13700
>Glyma15g13700.1   sequence type=predicted peptide   gene model=Glyma15g13700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MELARPASSRRKLKDLLLQSDNRLCADCNAPDPKWASANIGVFICLKCCGVHRSLGTHISKVLSVTLDDWSEDEIDAMMEVGGNASANSIYEAYIPEGYTKPGPDAGHEQRSKFIRSKYELQEFLKPSLRIVSGKSSLQSSSAKSSFMDSFKSTGSSQRMEGMVEFIGMLKVKVIKGTNLAIRDIKSSDPYVVLSLGQQTVQTTIIRSNLNPVWNEEYMLSVPEHYGQMKLKVFDHDTFSADDIMGEADIDLQSLITSAMAFGDAGMFGNMQIGKWLKSDDNALIEDSTVNIVDGKVKQMMSLKLQDVESGELDLELEWIPLEQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo