SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma15g11965

Feature Type:gene_model
Chromosome:Gm15
Start:8864036
stop:8866054
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G25070AT Annotation by Michelle Graham. TAIR10: RPM1 interacting protein 4 | chr3:9132458-9133747 FORWARD LENGTH=211 SoyBaseE_val: 2.00E-13ISS
GO:0002237GO-bp Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009816GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction SoyBaseN/AISS
GO:0010204GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-independent SoyBaseN/AISS
GO:0034051GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF05627PFAM Cleavage site for pathogenic type III effector avirulence factor Avr JGI ISS
UniRef100_G7ILR2UniRef Annotation by Michelle Graham. Most informative UniRef hit: RPM1-interacting protein n=1 Tax=Medicago truncatula RepID=G7ILR2_MEDTR SoyBaseE_val: 6.00E-60ISS
UniRef100_UPI0002337BC2UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002337BC2 related cluster n=1 Tax=unknown RepID=UPI0002337BC2 SoyBaseE_val: 1.00E-90ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g11965 not represented in the dataset

Glyma15g11965 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g01151 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g113100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g11965.1   sequence type=CDS   gene model=Glyma15g11965   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTGGCAACTGGGACCCCGACAACGTTCCGTACACTGCATATTTTGAGCATGCACGAAGAGAAAAGTCTGGGATCATGATAAATCCTAATGACCCAATGGAAAATCCAGGGGCTTTGAACACCGGATATTCTTTGGAAAATGGAAGCCATGTGCGTCCCAGGAGCAGGGGAAGTAATGGTGGCCTCACAGTCACAGCAGAGTTTGGCAGTGAACAGAGTCATTTTGATCACTCTGTGACCCACAGAAGCCCCCAATCAGATCACCAGAGGAACATGTCCAAAGGAGGAAGCAGCACTAAGAGCTTCTCTTCGTCAAGTCATAATACACACAGGAGTACAAACTCTTCCTTTAATGACCACGCAAACCATCGAGCAACTGCGATACCCAAATTTGGTATTTGGGATGTCACAAACCCAAAGTTAGGAGAGGGTTATACTGCTATTTTAAGCAAAATAAAAGAAGAGAGGGAAATTAAGTCTAGCCACGTCGACAGCATAAGCTCTCCACCACTGAACAATTCAAATATTAAGAATCAATATGGTGAATCTTCCTCCTGGGTTGGCTAA

>Glyma15g11965.1   sequence type=predicted peptide   gene model=Glyma15g11965   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFGNWDPDNVPYTAYFEHARREKSGIMINPNDPMENPGALNTGYSLENGSHVRPRSRGSNGGLTVTAEFGSEQSHFDHSVTHRSPQSDHQRNMSKGGSSTKSFSSSSHNTHRSTNSSFNDHANHRATAIPKFGIWDVTNPKLGEGYTAILSKIKEEREIKSSHVDSISSPPLNNSNIKNQYGESSSWVG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo