Glyma15g11850 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g11850

Feature Type:	gene_model
Chromosome:	Gm15
Start:	8726551
stop:	8734542
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g11850

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G62360	AT	Annotation by Michelle Graham. TAIR10: KNOX/ELK homeobox transcription factor \| chr1:23058796-23061722 REVERSE LENGTH=382	SoyBase	E_val: 7.00E-133	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007389	GO-bp	Annotation by Michelle Graham. GO Biological Process: pattern specification process	SoyBase	N/A	ISS
GO:0009691	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinin biosynthetic process	SoyBase	N/A	ISS
GO:0009855	GO-bp	Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry	SoyBase	N/A	ISS
GO:0009886	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-embryonic morphogenesis	SoyBase	N/A	ISS
GO:0009887	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ morphogenesis	SoyBase	N/A	ISS
GO:0009909	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of flower development	SoyBase	N/A	ISS
GO:0009934	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem structural organization	SoyBase	N/A	ISS
GO:0010051	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation	SoyBase	N/A	ISS
GO:0010093	GO-bp	Annotation by Michelle Graham. GO Biological Process: specification of floral organ identity	SoyBase	N/A	ISS
GO:0019827	GO-bp	Annotation by Michelle Graham. GO Biological Process: stem cell maintenance	SoyBase	N/A	ISS
GO:0048438	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral whorl development	SoyBase	N/A	ISS
GO:0048439	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower morphogenesis	SoyBase	N/A	ISS
GO:0048440	GO-bp	Annotation by Michelle Graham. GO Biological Process: carpel development	SoyBase	N/A	ISS
GO:0048481	GO-bp	Annotation by Michelle Graham. GO Biological Process: ovule development	SoyBase	N/A	ISS
GO:0048507	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem development	SoyBase	N/A	ISS
GO:0048513	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ development	SoyBase	N/A	ISS
GO:0048519	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
KOG0773	KOG	Transcription factor MEIS1 and related HOX domain proteins	JGI		ISS
PTHR11850	Panther	HOMEOBOX PROTEIN	JGI		ISS
PTHR11850:SF48	Panther	HOMEOBOX PROTEIN MEIS3	JGI		ISS
PF00046	PFAM	Homeobox domain	JGI		ISS
PF03789	PFAM	ELK domain	JGI		ISS
PF03790	PFAM	KNOX1 domain	JGI		ISS
PF03791	PFAM	KNOX2 domain	JGI		ISS
UniRef100_I1MFK9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MFK9_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_P46608	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Homeobox protein SBH1 n=1 Tax=Glycine max RepID=HSBH1_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma15g11850

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g11850

Paralog	Evidence	Comments
Glyma09g01000	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g11850 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g111900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g11850

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g11850

Limit To All Plant Sequences

>Glyma15g11850.1   sequence type=CDS   gene model=Glyma15g11850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGTAGTAGTTGCTCTAATGACACTTCTTATTTGTTGGCTTTTGGAGAAAACAGTGGTGGGCTATGCCCAATGACGATGATGCCTTTGGTAACTTCCCATCATGCAACAAATCCTAGTAATCCTAGTAATAATACTAATAATAATGAAAACACAAACTGTCTCTTCATTCCCAACTGCAGTAACAGTTCTGGAACTCCTTCTATCATGCTCCACAACAACAACAACACTGATGATGATAACAACAAAACCAGCACTAACACTGGGTTAGGGTACTATTTCATGGAGAGTGACCACCATCACCGCAACAACAACAACAATGGAAGCTCCTCCTCCTCTTCCTCTTCTGCTGTCAAGGCCAAGATCATGGCTCATCCTCACTATCACCGTCTCTTGGCAGCTTACGTCAATTGTCAGAAGGTTGGAGCCCCACCGGAAGTGGTGGCAAGGTTAGAAGAAGCATGTGCTTCTGCAGCGACAATGGCTGGTGATGCAGCAGCAGCAGCTGGATCAAGCTGCATAGGTGAAGATCCAGCTTTGGATCAGTTCATGGAGGCTTACTGTGAGATGCTCACCAAGTATGAGCAAGAACTCTCCAAACCCTTAAAGGAAGCCATGCTCTTCCTTCAAAGGATTGAGTGCCAGTTCAAAAATCTTACAATTTCTTCCACCGACTTTGCTTGCAACGAGGGTGCTGAGAGGAATGGATCATCTGAAGAGGATGTTGATCTACACAACATGATAGATCCCCAGGCAGAGGACAGGGAATTAAAGGGTCAGCTTTTGCGCAAGTACAGCGGATACCTGGGCAGTCTGAAGCAAGAATTCATGAAGAAGAGGAAGAAAGGAAAGCTACCTAAAGAAGCAAGGCAACAATTACTTGAATGGTGGAGCAGACATTACAAATGGCCTTACCCATCCGAGTCACAGAAGCTGGCCCTTGCAGAGTCGACAGGTCTGGATCAGAAGCAAATCAACAACTGGTTTATTAATCAAAGGAAACGGCACTGGAAGCCTTCAGAGGACATGCAGTTTGTGGTGATGGATCCAAGCCATCCACACTATTACATGGATAATGTTCTGGGCAATCCATTTCCCATGGATCTCTCCCATCCAATGCTCTAG

Predicted protein sequences of Glyma15g11850

Limit To All Plant Sequences

>Glyma15g11850.1   sequence type=predicted peptide   gene model=Glyma15g11850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGSSCSNDTSYLLAFGENSGGLCPMTMMPLVTSHHATNPSNPSNNTNNNENTNCLFIPNCSNSSGTPSIMLHNNNNTDDDNNKTSTNTGLGYYFMESDHHHRNNNNNGSSSSSSSSAVKAKIMAHPHYHRLLAAYVNCQKVGAPPEVVARLEEACASAATMAGDAAAAAGSSCIGEDPALDQFMEAYCEMLTKYEQELSKPLKEAMLFLQRIECQFKNLTISSTDFACNEGAERNGSSEEDVDLHNMIDPQAEDRELKGQLLRKYSGYLGSLKQEFMKKRKKGKLPKEARQQLLEWWSRHYKWPYPSESQKLALAESTGLDQKQINNWFINQRKRHWKPSEDMQFVVMDPSHPHYYMDNVLGNPFPMDLSHPML*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain