Glyma15g11255 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g11255

Feature Type:	gene_model
Chromosome:	Gm15
Start:	8247413
stop:	8248301
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g11255

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_A0ZXY5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peroxiredoxin II F (Fragment) n=1 Tax=Pisum sativum RepID=A0ZXY5_PEA	SoyBase	E_val: 2.00E-06	ISS
UniRef100_UPI000233BE99	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233BE99 related cluster n=1 Tax=unknown RepID=UPI000233BE99	SoyBase	E_val: 2.00E-27	ISS

Expression Patterns of Glyma15g11255

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g11255 not represented in the dataset	Glyma15g11255 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g11255

Paralog	Evidence	Comments
Glyma13g27701	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g11255 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma15g11255

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g11255

Limit To All Plant Sequences

>Glyma15g11255.1   sequence type=CDS   gene model=Glyma15g11255   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACACCCGGTTTGGTGAAGCGACTCACCAAGTCATTGTCTGCAACTCTTGGGTTCAGATCTTCTTCCTCTGTCGCCAAGGTTACAACTGGAACTGACCTTCTCTCGATTGCACATAATGTTTCTCTTCAGAAAGCTCTCACGTGGGACGAAGGCGTTGCTTCTATGCCATTCTCATTTTCAAACCATTTTTATCCTTTTGGCTCAGTTACTATAACTAATGTCCTCTCCCCACGATGTTTCAGTACAAGAAAGTGGTCATATTTGGAATCCCGGATGCATTCACAGGGGTTTGTTCAGAAGAACATGTTCCAACTTACATGGATAATATTGATAAGTTTAAGGCTAAGGGAATCCATGCCGTTATTCGTGTCTCGATTAATGATCCATTTACTATGA

Predicted protein sequences of Glyma15g11255

Limit To All Plant Sequences

>Glyma15g11255.1   sequence type=predicted peptide   gene model=Glyma15g11255   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTPGLVKRLTKSLSATLGFRSSSSVAKVTTGTDLLSIAHNVSLQKALTWDEGVASMPFSFSNHFYPFGSVTITNVLSPRCFSTRKWSYLESRMHSQGFVQKNMFQLTWIILISLRLRESMPLFVSRLMIHLL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain