Glyma15g11250 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g11250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g11250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g11250

Feature Type:	gene_model
Chromosome:	Gm15
Start:	8243470
stop:	8249415
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g11250

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G06050	AT	Annotation by Michelle Graham. TAIR10: peroxiredoxin IIF \| chr3:1826311-1827809 REVERSE LENGTH=201	SoyBase	E_val: 9.00E-100	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009060	GO-bp	Annotation by Michelle Graham. GO Biological Process: aerobic respiration	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005759	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix	SoyBase	N/A	ISS
GO:0004601	GO-mf	Annotation by Michelle Graham. GO Molecular Function: peroxidase activity	SoyBase	N/A	ISS
GO:0016209	GO-mf	Annotation by Michelle Graham. GO Molecular Function: antioxidant activity	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
KOG0541	KOG	Alkyl hydroperoxide reductase/peroxiredoxin	JGI		ISS
PTHR10430	Panther	PEROXIREDOXIN-5	JGI		ISS
PF08534	PFAM	Redoxin	JGI		ISS
UniRef100_C6T2A9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T2A9_SOYBN	SoyBase	E_val: 2.00E-140	ISS
UniRef100_H6VUU5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peroxiredoxin n=1 Tax=Ammopiptanthus mongolicus RepID=H6VUU5_9FABA	SoyBase	E_val: 9.00E-117	ISS

Expression Patterns of Glyma15g11250

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g11250 not represented in the dataset	Glyma15g11250 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g11250

Paralog	Evidence	Comments
Glyma13g27710	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g11250 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g105600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g11250

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma15g11250

Limit To All Plant Sequences

>Glyma15g11250.2   sequence type=transcript   gene model=Glyma15g11250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATTGGAATGTTGTTTCTTTTTCTTTCCATAGAATTCAGTGCTGAGCCTTTGTAGAAATTTGTGATGGCATCGGTTATGGTGAATCGAGGTGGTTCCAGGATCATCAAGTCAGTGTCTGCAGCTCTTGGTACGAGGTTTTTCGCAAAGGTTGCAACTGGGACTGACATAGTCTCTGCCGCACCCAATGCTTCTCTCCAGAAAGCTCGTACCTGGGACGAGGGTCTTGCTTCCAAGTTCTCCACCACTCCTCTCAAAGACATCTTCAAGGACAAGAAAGTTGTCATCTTTGGGCTCCCAGGTGCATACACAGGAGTTTGTTCAAACAAACATGTTCCTCCTTACAAGGAGAATATTGATAAGTTTAAGGCTAAGGGGATAGATTCTGTTATTTGTGTGGCTATTAATGATCCATATACTATGAATGCGTGGGCTGAGAAGCTTCAAGCCAAAGATGCTATTGAGTTTTATGGGGACTTTGACGGGAGCTTTCACAAAAGTTTGGAATTAGTTACTGATCTCTCTGGTGCATTGCTTGGAACTCGATCAGAAAGATGGTCAGCATGTGTGGTAGATGGAGTGATTACAGCTCTTAATGTTGAAGAAGATCCGTCTGTTGTCACGGTTTCTGCTGCACAGACTATTTTGGAACAGATTTGA

Coding sequences of Glyma15g11250

Limit To All Plant Sequences

>Glyma15g11250.1   sequence type=CDS   gene model=Glyma15g11250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCGGTTATGGTGAATCGAGGTGGTTCCAGGATCATCAAGTCAGTGTCTGCAGCTCTTGGTACGAGGTTTTTCGCAAAGGTTGCAACTGGGACTGACATAGTCTCTGCCGCACCCAATGCTTCTCTCCAGAAAGCTCGTACCTGGGACGAGGGTCTTGCTTCCAAGTTCTCCACCACTCCTCTCAAAGACATCTTCAAGGACAAGAAAGTTGTCATCTTTGGGCTCCCAGGTGCATACACAGGAGTTTGTTCAAACAAACATGTTCCTCCTTACAAGGAGAATATTGATAAGTTTAAGGCTAAGGGGATAGATTCTGTTATTTGTGTGGCTATTAATGATCCATATACTATGAATGCGTGGGCTGAGAAGCTTCAAGCCAAAGATGCTATTGAGTTTTATGGGGACTTTGACGGGAGCTTTCACAAAAGTTTGGAATTAGTTACTGATCTCTCTGGTGCATTGCTTGGAACTCGATCAGAAAGATGGTCAGCATACGTGGTAGATGGAAAGGTTAAGGCTCTTAATGTTGAAGAAGCTCCATCTGATGTTAAGGTTTCTGGCGCAGATACCATTTTGGGACAGATTTGA

>Glyma15g11250.2   sequence type=CDS   gene model=Glyma15g11250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCGGTTATGGTGAATCGAGGTGGTTCCAGGATCATCAAGTCAGTGTCTGCAGCTCTTGGTACGAGGTTTTTCGCAAAGGTTGCAACTGGGACTGACATAGTCTCTGCCGCACCCAATGCTTCTCTCCAGAAAGCTCGTACCTGGGACGAGGGTCTTGCTTCCAAGTTCTCCACCACTCCTCTCAAAGACATCTTCAAGGACAAGAAAGTTGTCATCTTTGGGCTCCCAGGTGCATACACAGGAGTTTGTTCAAACAAACATGTTCCTCCTTACAAGGAGAATATTGATAAGTTTAAGGCTAAGGGGATAGATTCTGTTATTTGTGTGGCTATTAATGATCCATATACTATGAATGCGTGGGCTGAGAAGCTTCAAGCCAAAGATGCTATTGAGTTTTATGGGGACTTTGACGGGAGCTTTCACAAAAGTTTGGAATTAGTTACTGATCTCTCTGGTGCATTGCTTGGAACTCGATCAGAAAGATGGTCAGCATGTGTGGTAGATGGAGTGATTACAGCTCTTAATGTTGAAGAAGATCCGTCTGTTGTCACGGTTTCTGCTGCACAGACTATTTTGGAACAGATTTGA

Predicted protein sequences of Glyma15g11250

Limit To All Plant Sequences

>Glyma15g11250.1   sequence type=predicted peptide   gene model=Glyma15g11250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASVMVNRGGSRIIKSVSAALGTRFFAKVATGTDIVSAAPNASLQKARTWDEGLASKFSTTPLKDIFKDKKVVIFGLPGAYTGVCSNKHVPPYKENIDKFKAKGIDSVICVAINDPYTMNAWAEKLQAKDAIEFYGDFDGSFHKSLELVTDLSGALLGTRSERWSAYVVDGKVKALNVEEAPSDVKVSGADTILGQI*

>Glyma15g11250.2   sequence type=predicted peptide   gene model=Glyma15g11250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASVMVNRGGSRIIKSVSAALGTRFFAKVATGTDIVSAAPNASLQKARTWDEGLASKFSTTPLKDIFKDKKVVIFGLPGAYTGVCSNKHVPPYKENIDKFKAKGIDSVICVAINDPYTMNAWAEKLQAKDAIEFYGDFDGSFHKSLELVTDLSGALLGTRSERWSACVVDGVITALNVEEDPSVVTVSAAQTILEQI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain