SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g10610

Feature Type:gene_model
Chromosome:Gm15
Start:7699583
stop:7702106
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g10610
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G15560AT Annotation by Michelle Graham. TAIR10: Deoxyxylulose-5-phosphate synthase | chr4:8884218-8887254 FORWARD LENGTH=717 SoyBaseE_val: 0ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0015994GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll metabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016114GO-bp Annotation by Michelle Graham. GO Biological Process: terpenoid biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019216GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of lipid metabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031408GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process SoyBaseN/AISS
GO:0032880GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein localization SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008661GO-mf Annotation by Michelle Graham. GO Molecular Function: 1-deoxy-D-xylulose-5-phosphate synthase activity SoyBaseN/AISS
GO:0016624GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor SoyBaseN/AISS
PTHR11624Panther DEHYDROGENASE RELATED JGI ISS
PTHR11624:SF20Panther ACETOIN DEHYDROGENASE JGI ISS
PF02779PFAM Transketolase, pyrimidine binding domain JGI ISS
PF02780PFAM Transketolase, C-terminal domain JGI ISS
UniRef100_B9RSX4UniRef Annotation by Michelle Graham. Most informative UniRef hit: 1-deoxyxylulose-5-phosphate synthase, putative n=1 Tax=Ricinus communis RepID=B9RSX4_RICCO SoyBaseE_val: 0ISS
UniRef100_I1MF87UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1MF87_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma15g10610
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g10610
ParalogEvidenceComments
Glyma13g28470 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g10610 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g099300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g10610
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g10610
>Glyma15g10610.1   sequence type=CDS   gene model=Glyma15g10610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTAGCAGTTCTGGATCAACACTGTTTGAAGAGCTTGGACTTTACTATATAGGTCCCGTTGATGGTCATAACATGAATGATCTTGTTGCCATTCTCAATGAAGTTAAAAATACTGAAACAACTGGTCCCTGCGTGATCCATGTTGTCACTGAAAAAGGCCACGGATACCCTTATGCAGAAAGAGCAGCAGCCAAGTACCATGTGGTATCTAAGTTTGATCCAGCAACTGGAGAACAATTCAAGGCCAAGGCCACCACCAAGTCATATTCAACATACTTTGCAGAGGCTTTGATTGCAGAAGCAGAAGCTGACAAAGACATTATTGGAATTCATGCTGCGATGGGAGGTGGAACTGGCATGAATCACTTCCTTCGTCGTTTCCCAACAAGATGCTTTGATGTGGGGATAGCAGAACAGCATGCTGTTACCTTTGCGGCAGGCTTGGCTTGTGAAGGTTTTAAGCCTTTTTGTGCAATTAACTCATCCTTCATGCAGAGAGCTTATGACCAGGTGGTGCATGATGTGGATTTGCAAAAGCTGCCTGTAAGATTTGGAATAGACAGAGCTGGATTAGTTGGACCAGATGGTTGCACACACTGTGGTGCATTTGATGTCACTTTTATGGCATGCCTCCCTAACATGGTGGTGATGGCTCCTTCTGATGAAGCAGAGCTTTTTCATATGGTTGCCACTGCAGCTGCCATTGATGATCGACCCAGTTGTTTCCGATACCCGAGAGGGAATGGTGTTGGTGTTGAACTACCACCAGGGAATAAAGGCATTCCTCTTGAGATTGGGAAAGGTAGGATACTAATTGAAGGGGAAAGAGTGGCTTTGTTGGGCTATGGATCAACTGTTCAGAGCTGTGTGGCTGCTGCTACCCTCTTGGGAGATCTTGGCTTGCATGCAACAGTGGTGAATGCACGTTTCTGCAAGCCATTGGATCATTCCCTAATTCGAAGCCTTGCAAAATCGCACGAGGTTTTGATCACCGTGGAAGAAGGATCAATAGGAGGATTTGGGTCTCATGTTGCTCAGTTCATGGCCCTTGATGGCCTTCTTGATGGAAAATTGAAGTGGAGGCCAATGGTTCTTCCTGATTGTTACATTGACCATGGATCACCTGCTGACCAATTGAATGAAGCTAGACTTACACCATCTCACATAGCAGCAACAGTTTTCAATTTACTTGGACAGGCAAGAGAGGAACTAGAGGTCATGACAAAAGAGAAATGCAAAGAAGGGGTTCAATTTTCATCCCCTGAAATGTACAAAGTAGCGTGA
Predicted protein sequences of Glyma15g10610
>Glyma15g10610.1   sequence type=predicted peptide   gene model=Glyma15g10610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MISSSGSTLFEELGLYYIGPVDGHNMNDLVAILNEVKNTETTGPCVIHVVTEKGHGYPYAERAAAKYHVVSKFDPATGEQFKAKATTKSYSTYFAEALIAEAEADKDIIGIHAAMGGGTGMNHFLRRFPTRCFDVGIAEQHAVTFAAGLACEGFKPFCAINSSFMQRAYDQVVHDVDLQKLPVRFGIDRAGLVGPDGCTHCGAFDVTFMACLPNMVVMAPSDEAELFHMVATAAAIDDRPSCFRYPRGNGVGVELPPGNKGIPLEIGKGRILIEGERVALLGYGSTVQSCVAAATLLGDLGLHATVVNARFCKPLDHSLIRSLAKSHEVLITVEEGSIGGFGSHVAQFMALDGLLDGKLKWRPMVLPDCYIDHGSPADQLNEARLTPSHIAATVFNLLGQAREELEVMTKEKCKEGVQFSSPEMYKVA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo