Glyma15g10431 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g10431): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g10431): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g10431

Feature Type:	gene_model
Chromosome:	Gm15
Start:	7554946
stop:	7556592
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g10431

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G15610	AT	Annotation by Michelle Graham. TAIR10: Uncharacterised protein family (UPF0497) \| chr4:8909162-8910641 FORWARD LENGTH=193	SoyBase	E_val: 3.00E-16	ISS
GO:0006865	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid transport	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005802	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PTHR11615	Panther	NITRATE, FROMATE, IRON DEHYDROGENASE	JGI		ISS
PTHR11615:SF54	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF04535	PFAM	Domain of unknown function (DUF588)	JGI		ISS
UniRef100_A7NW79	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CASP-like protein VIT_05s0020g01830 n=1 Tax=Vitis vinifera RepID=CSPL7_VITVI	SoyBase	E_val: 2.00E-16	ISS
UniRef100_I1MF64	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MF64_SOYBN	SoyBase	E_val: 2.00E-27	ISS

Expression Patterns of Glyma15g10431

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g10431 not represented in the dataset	Glyma15g10431 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g10431 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g097600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g10431

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma15g10431

Limit To All Plant Sequences

>Glyma15g10431.2   sequence type=transcript   gene model=Glyma15g10431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTTGGTTGTAACTTTCTATTCCCACTTAGTCTACTAGTAGCACCTGCCATTCAAATCAAATTCATTAGCCACCTTGCAGATCAGCATTTCATGGCTACTACAGACCTTGAGAACAAATCATCAACTCCACCACCGCCTCCGGCCGATGTGGATTACTCTAAAGTTGACGTGATCCTCAGAATTCTGTTGTTGGCAGCATCAGTGGAAGTGCTTGCAGTGATTGTCTCCGGTGATCAAACAGAGCAATTGCTCTTCCAAGATGTGCTTGTACCACAGCCAGCCAAGTTCAAATACTAACCAGCTTTTGTATATTTTGTGGCTGCATTCAGTGTTTCTGGCCTTTATGCCCTCGTTTCTGCTCTTGCATCTATCTCTGTCATCCAGAAGCCAGAATTCAAACTGAAGTTCCTCCTCCACTTTATCTTCTGGGATGCATGCAACTGATATTGGGGATAACAACCTCAGCAACAGGAGCAGCCGGAAGAGGGGCATATATTGGTTTAAAGGGCAACTACCGTGTGGATTGGATTAAAGTTTGCAACGTCTACGACAAGTTCTGTAGGCATCTTGCTGGCTCCATAGCAGTGGCTTTGTTGTATTGTGACCGTCCTTCTCATCATAGATATGCACTCAACTCCAGATTTACATTGTTCACAAAATCAGTCAATGTGTCCGTTAATGTTCATATATCGACATGGATAGCTTTTGTTGTTGCTGAGTGTTTCTTCAAAGGTGTTGATTATGTGTAGTGAAGAATGTTAACTACACTCTGTATGAACATTCTTTTCGACAGTCTTTGTTATTGAATGAAATCATGAGTCTTACTAAATGTTGTAGGTCTATTCCTTAT

Coding sequences of Glyma15g10431

Limit To All Plant Sequences

>Glyma15g10431.1   sequence type=CDS   gene model=Glyma15g10431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGCTTGTACCACAGCCAGCCAAGTTCAAATACTAACCAGCTTTTGTTGCAACTGATATTGGGGATAACAACCTCAGCAACAGGAGCAGCCGGAAGAGGGGCATATATTGGTTTAAAGGGCAACTACCGTGTGGATTGGATTAAAGTTTGCAACGTCTACGACAAGTTCTGTAGGCATCTTGCTGGCTCCATAGCAGTGGCTTTGTTGTATTGTGACCGTCCTTCTCATCATAGATATGCACTCAACTCCAGATTTACATTGTTCACAAAATCAGTCAATGTGTCCGTTAATGTTCATATATCGACATGGATAGCTTTTGTTGTTGCTGAGTGTTTCTTCAAAGGTGTTGATTATGTGTAG

>Glyma15g10431.2   sequence type=CDS   gene model=Glyma15g10431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAACTGATATTGGGGATAACAACCTCAGCAACAGGAGCAGCCGGAAGAGGGGCATATATTGGTTTAAAGGGCAACTACCGTGTGGATTGGATTAAAGTTTGCAACGTCTACGACAAGTTCTGTAGGCATCTTGCTGGCTCCATAGCAGTGGCTTTGTTGTATTGTGACCGTCCTTCTCATCATAGATATGCACTCAACTCCAGATTTACATTGTTCACAAAATCAGTCAATGTGTCCGTTAATGTTCATATATCGACATGGATAGCTTTTGTTGTTGCTGAGTGTTTCTTCAAAGGTGTTGATTATGTGTAG

Predicted protein sequences of Glyma15g10431

Limit To All Plant Sequences

>Glyma15g10431.1   sequence type=predicted peptide   gene model=Glyma15g10431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCLYHSQPSSNTNQLLLQLILGITTSATGAAGRGAYIGLKGNYRVDWIKVCNVYDKFCRHLAGSIAVALLYCDRPSHHRYALNSRFTLFTKSVNVSVNVHISTWIAFVVAECFFKGVDYV*

>Glyma15g10431.2   sequence type=predicted peptide   gene model=Glyma15g10431   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQLILGITTSATGAAGRGAYIGLKGNYRVDWIKVCNVYDKFCRHLAGSIAVALLYCDRPSHHRYALNSRFTLFTKSVNVSVNVHISTWIAFVVAECFFKGVDYV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain