SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g10210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g10210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g10210

Feature Type:gene_model
Chromosome:Gm15
Start:7418177
stop:7420616
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52580AT Annotation by Michelle Graham. TAIR10: Ribosomal protein S11 family protein | chr3:19503324-19504701 FORWARD LENGTH=150 SoyBaseE_val: 5.00E-90ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0042545GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall modification SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0022627GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG0407 KOG 40S ribosomal protein S14 JGI ISS
PTHR11759Panther 40S RIBOSOMAL PROTEIN S14/30S RIBOSOMAL PROTEIN S11 JGI ISS
PF00411PFAM Ribosomal protein S11 JGI ISS
UniRef100_B3TM39UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein S14 n=1 Tax=Elaeis guineensis RepID=B3TM39_ELAGV SoyBaseE_val: 1.00E-90ISS
UniRef100_C6SZX2UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6SZX2_SOYBN SoyBaseE_val: 2.00E-102ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g10210 not represented in the dataset

Glyma15g10210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g28840 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g095300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g10210.1   sequence type=CDS   gene model=Glyma15g10210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGAGGAGAAAGGTTAGGGAGCCAAAGGAGGAAAATGTCACTCTTGGTCCAGCCGTTAGAGACGGTGAACATGTTTTCGGCGTGGCTCGCATCTTTGCCTCCTTCAACGACACCTTCATCCATGTCACTGATTTGTCTGGGAGGGAAACCCTTGTTCGCATCACTGGTGGGATGAAAGTTAAAGCTGACAGAGATGAATCATCTCCATATGCTGCTATGCTTGCAGCACAGGATGTTGCTGCCAGATGTAAGGAACTGGGCATAACTGCTCTTCATATCAGGCTCCGTGCCACTGGTGGAAACAAGACCAAAACACCTGGTCCTGGTGCTCAATCAGCTCTTCGAGCCCTTGCACGTTCAGGAATGAAAATTGGTCGTATAGAGGATGTTACTCCCATTCCTTCGGATAGTACACGTAGAAAGAGTGGTAGAAGGGGTAGAAGACTTTAA

>Glyma15g10210.1   sequence type=predicted peptide   gene model=Glyma15g10210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRRKVREPKEENVTLGPAVRDGEHVFGVARIFASFNDTFIHVTDLSGRETLVRITGGMKVKADRDESSPYAAMLAAQDVAARCKELGITALHIRLRATGGNKTKTPGPGAQSALRALARSGMKIGRIEDVTPIPSDSTRRKSGRRGRRL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo