Glyma15g10100 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g10100

Feature Type:	gene_model
Chromosome:	Gm15
Start:	7318943
stop:	7319777
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g10100

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G46230	AT	Annotation by Michelle Graham. TAIR10: Protein of unknown function, DUF538 \| chr5:18742593-18743024 REVERSE LENGTH=143	SoyBase	E_val: 2.00E-50	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
PF04398	PFAM	Protein of unknown function, DUF538	JGI		ISS
UniRef100_Q2R1S6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Oryza sativa Japonica Group RepID=Q2R1S6_ORYSJ	SoyBase	E_val: 6.00E-46	ISS
UniRef100_UPI000233BD0C	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233BD0C related cluster n=1 Tax=unknown RepID=UPI000233BD0C	SoyBase	E_val: 6.00E-116	ISS

Expression Patterns of Glyma15g10100

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g10100 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g094200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g10100

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g10100

Limit To All Plant Sequences

>Glyma15g10100.2   sequence type=CDS   gene model=Glyma15g10100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACCGCAAAAATAGAGCACCACCGCGAGGAAGCTGAGATCTACGAGGGCGAAGCGGTGTGCACGCAAAAGTCACGTCTCCTCTTGGACGAGATTCTCCTCCCAAGAGGCTTGCTCCCGCTGGAGAACATCGTGGAGATGGGTTACAACCGCACCACGGGGTTCGTGTGGCTGAAGCAGAGGCACAAGAAGGAGCACCGCTTCGCCACCATCGGACGCACCGTCTCGTACGCAACGGAGGTGACGGCGTTCGTGGAGGAGCACCGCATGCGGAGGGTGACGGGTGTCAAGACCAAAGAGCTCTTCATATGGGTCAGCATCTCCGAGATCTTCGTGGATGACCCTGCTTCCGGTAAGATAACGTTCGCCAACTCCTCTGGGATTGCAAGGTCTTTTCCTCTCTCAGCATTCTCTCTCCAAGAGGAACATCAACAACAACAGCAAGAACATGATCATGCAGAAACGTACCTATCAACCAAATCATGA

Predicted protein sequences of Glyma15g10100

Limit To All Plant Sequences

>Glyma15g10100.2   sequence type=predicted peptide   gene model=Glyma15g10100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATAKIEHHREEAEIYEGEAVCTQKSRLLLDEILLPRGLLPLENIVEMGYNRTTGFVWLKQRHKKEHRFATIGRTVSYATEVTAFVEEHRMRRVTGVKTKELFIWVSISEIFVDDPASGKITFANSSGIARSFPLSAFSLQEEHQQQQQEHDHAETYLSTKS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain