Glyma15g09303 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g09303): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g09303): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g09303

Feature Type:	gene_model
Chromosome:	Gm15
Start:	6633689
stop:	6634055
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g09303

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G75390	AT	Annotation by Michelle Graham. TAIR10: basic leucine-zipper 44 \| chr1:28292224-28292745 FORWARD LENGTH=173	SoyBase	E_val: 1.00E-16	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009410	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
GO:0046982	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein heterodimerization activity	SoyBase	N/A	ISS
GO:0046983	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity	SoyBase	N/A	ISS
UniRef100_Q0GPF8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: BZIP transcription factor bZIP124 n=1 Tax=Glycine max RepID=Q0GPF8_SOYBN	SoyBase	E_val: 2.00E-47	ISS
UniRef100_UPI000233BB9B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233BB9B related cluster n=1 Tax=unknown RepID=UPI000233BB9B	SoyBase	E_val: 2.00E-52	ISS

Expression Patterns of Glyma15g09303

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g09303 not represented in the dataset	Glyma15g09303 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g09303 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma15g09303

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g09303

Limit To All Plant Sequences

>Glyma15g09303.1   sequence type=CDS   gene model=Glyma15g09303   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAACAGTACCTGAGTGTTGAGGTTGAGAACTCGGTGCTTAGGGCTCAGGTGGGTGAGCTTAGTCACAGGTTAGAGTCTCTGAATGAGATCGTTGACGTGTTGAATGCCACTATTGTGGCGGGTTTTGGAGCAGCAACAACATCGAGCACCTTCGTTGAGCCAATTAATAATAATAATAATAATAGCTTCTTCAACCCGTTGAATATGGGGTATCTGAACCACCCTATTATGACTTCTGCGGATATATTGCAGTACTGA

Predicted protein sequences of Glyma15g09303

Limit To All Plant Sequences

>Glyma15g09303.1   sequence type=predicted peptide   gene model=Glyma15g09303   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQQYLSVEVENSVLRAQVGELSHRLESLNEIVDVLNATIVAGFGAATTSSTFVEPINNNNNNSFFNPLNMGYLNHPIMTSADILQY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain