|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G75390 | AT | Annotation by Michelle Graham. TAIR10: basic leucine-zipper 44 | chr1:28292224-28292745 FORWARD LENGTH=173 | SoyBase | E_val: 1.00E-16 | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0009410 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus | SoyBase | N/A | ISS |
| GO:0030968 | GO-bp | Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0003677 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: DNA binding | SoyBase | N/A | ISS |
| GO:0003700 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity | SoyBase | N/A | ISS |
| GO:0043565 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding | SoyBase | N/A | ISS |
| GO:0046982 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein heterodimerization activity | SoyBase | N/A | ISS |
| GO:0046983 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity | SoyBase | N/A | ISS |
| UniRef100_Q0GPF8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: BZIP transcription factor bZIP124 n=1 Tax=Glycine max RepID=Q0GPF8_SOYBN | SoyBase | E_val: 2.00E-47 | ISS |
| UniRef100_UPI000233BB9B | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233BB9B related cluster n=1 Tax=unknown RepID=UPI000233BB9B | SoyBase | E_val: 2.00E-52 | ISS |
|
Glyma15g09303 not represented in the dataset |
Glyma15g09303 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma15g09303.1 sequence type=CDS gene model=Glyma15g09303 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGCAACAGTACCTGAGTGTTGAGGTTGAGAACTCGGTGCTTAGGGCTCAGGTGGGTGAGCTTAGTCACAGGTTAGAGTCTCTGAATGAGATCGTTGACGTGTTGAATGCCACTATTGTGGCGGGTTTTGGAGCAGCAACAACATCGAGCACCTTCGTTGAGCCAATTAATAATAATAATAATAATAGCTTCTTCAACCCGTTGAATATGGGGTATCTGAACCACCCTATTATGACTTCTGCGGATATATTGCAGTACTGA
>Glyma15g09303.1 sequence type=predicted peptide gene model=Glyma15g09303 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MQQYLSVEVENSVLRAQVGELSHRLESLNEIVDVLNATIVAGFGAATTSSTFVEPINNNNNNSFFNPLNMGYLNHPIMTSADILQY*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||