Report for Sequence Feature Glyma15g09090
Feature Type: gene_model
Chromosome: Gm15
Start: 6457385
stop: 6461926
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma15g09090
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G18710 AT
Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr4:10296474-10298913 FORWARD LENGTH=380
SoyBase E_val: 0 ISS
GO:0006096 GO-bp
Annotation by Michelle Graham. GO Biological Process: glycolysis
SoyBase N/A ISS
GO:0006468 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein phosphorylation
SoyBase N/A ISS
GO:0006833 GO-bp
Annotation by Michelle Graham. GO Biological Process: water transport
SoyBase N/A ISS
GO:0006972 GO-bp
Annotation by Michelle Graham. GO Biological Process: hyperosmotic response
SoyBase N/A ISS
GO:0007030 GO-bp
Annotation by Michelle Graham. GO Biological Process: Golgi organization
SoyBase N/A ISS
GO:0009266 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0009729 GO-bp
Annotation by Michelle Graham. GO Biological Process: detection of brassinosteroid stimulus
SoyBase N/A ISS
GO:0009733 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus
SoyBase N/A ISS
GO:0009742 GO-bp
Annotation by Michelle Graham. GO Biological Process: brassinosteroid mediated signaling pathway
SoyBase N/A ISS
GO:0009825 GO-bp
Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth
SoyBase N/A ISS
GO:0009965 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis
SoyBase N/A ISS
GO:0046686 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cadmium ion
SoyBase N/A ISS
GO:0046777 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation
SoyBase N/A ISS
GO:0046827 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of protein export from nucleus
SoyBase N/A ISS
GO:0048767 GO-bp
Annotation by Michelle Graham. GO Biological Process: root hair elongation
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0004672 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein kinase activity
SoyBase N/A ISS
GO:0004674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity
SoyBase N/A ISS
GO:0004713 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0016301 GO-mf
Annotation by Michelle Graham. GO Molecular Function: kinase activity
SoyBase N/A ISS
GO:0016772 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups
SoyBase N/A ISS
KOG0658
KOG
Glycogen synthase kinase-3
JGI ISS
PTHR24057 Panther
GLYCOGEN SYNTHASE KINASE-3 ALPHA
JGI ISS
PF00069 PFAM
Protein kinase domain
JGI ISS
UniRef100_B9S8B2 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glycogen synthase kinase-3 beta, putative n=2 Tax=Ricinus communis RepID=B9S8B2_RICCO
SoyBase E_val: 0 ISS
UniRef100_I1MEU1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MEU1_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma15g09090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma15g09090
Paralog Evidence Comments
Glyma13g30060 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma15g09090 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.15g084400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma15g09090
Coding sequences of Glyma15g09090
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma15g09090.1 sequence type=CDS gene model=Glyma15g09090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACTGAGGATAAGGAGATGTCTTCCTCTGTCACCAATGGCGATGATTCCCTCACTGGTCACATCATATCTACAACTATTGGAGGCAAAAATGGGGAACCCAAACAGACTATTAGTTACATGGCAGAACGGGTTGTAGGAACTGGATCATTTGGAATTGTTTTCCAGGCAAAATGCTTGGAAACTGGGGAAGCAGTGGCTATTAAAAAGGTTTTACAGGACAGAAGATACAAGAATCGCGAACTACAGTTAATGCGTGTTTTGGATCATCCAAATGTGATCTCTTTGAAGCATTGTTTCTTTTCAACTACAAGTACAGATGAGCTTTTTCTTAATTTGGTGATGGAATATGTTCCAGAGTCTATGTATAGAGTCATTAAGCACTATACCAATGCTAATCAAAGAATGCCAATCATCTATGTAAAACTTTATATGTACCAGATTTTCAGGGGGCTGGCTTATATACACACTGTGCCCAAAGTTTGCCACAGAGACTTGAAGCCTCAAAATATATTGGTGGATCCTCTTACACACCAAGTGAAGCTATGTGATTTTGGAAGTGCAAAAGTTCTAGTAAAAGGTGAAGCTAATATATCATACATATGTTCACGATTCTATCGTGCTCCAGAACTTATATTTGGTGCCACAGAGTATACAAGTTCAATTGATATTTGGTCAGCTGGCTGTGTCCTTGCTGAGCTTCTTTTGGGCCAGCCATTATTCCCTGGCGAAAATGCAGTAGACCAGCTCGTACATATTATAAAGGTGCTTGGCACACCCACTCGAGAGGAAGTACGCTGTATGAATCCCAATTACAATGACTTTAGGTTTCCACAGATAAAAGCACACCCATGGCACAAGATATTCCACAAAAAGATGCCTCCAGAAGCAATTGATCTTGCATCCCGGCTTTTGCAATACTCCCCAAGTCTCCGATGCACTGCGCTTGAAGCATGTGCACATCCTTTCTTTGATGAACTTCGAGAACCCCATGCTCGCCTGCCAAATGGTCGTCCATTTCCTCCTCTATTTAACTTCAAACAGGAATTATCTGAAGCATCTCCAGTGCTTGTTAACAAATTGATACCTGACCACGTGAAGCGGCAAATAGGGCTGCAATTTGTTCCTCCAGCAGGATCATGA
Predicted protein sequences of Glyma15g09090
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma15g09090.1 sequence type=predicted peptide gene model=Glyma15g09090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTEDKEMSSSVTNGDDSLTGHIISTTIGGKNGEPKQTISYMAERVVGTGSFGIVFQAKCLETGEAVAIKKVLQDRRYKNRELQLMRVLDHPNVISLKHCFFSTTSTDELFLNLVMEYVPESMYRVIKHYTNANQRMPIIYVKLYMYQIFRGLAYIHTVPKVCHRDLKPQNILVDPLTHQVKLCDFGSAKVLVKGEANISYICSRFYRAPELIFGATEYTSSIDIWSAGCVLAELLLGQPLFPGENAVDQLVHIIKVLGTPTREEVRCMNPNYNDFRFPQIKAHPWHKIFHKKMPPEAIDLASRLLQYSPSLRCTALEACAHPFFDELREPHARLPNGRPFPPLFNFKQELSEASPVLVNKLIPDHVKRQIGLQFVPPAGS*