Glyma15g08370 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g08370

Feature Type:	gene_model
Chromosome:	Gm15
Start:	5919155
stop:	5920737
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g08370

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G44210	AT	Annotation by Michelle Graham. TAIR10: erf domain protein 9 \| chr5:17806742-17807344 FORWARD LENGTH=200	SoyBase	E_val: 5.00E-36	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006857	GO-bp	Annotation by Michelle Graham. GO Biological Process: oligopeptide transport	SoyBase	N/A	ISS
GO:0009873	GO-bp	Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_B3VHW0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ethylene-responsive element binding factor 4 n=1 Tax=Glycine max RepID=B3VHW0_SOYBN	SoyBase	E_val: 2.00E-104	ISS
UniRef100_I1MEL9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MEL9_SOYBN	SoyBase	E_val: 3.00E-156	ISS

Expression Patterns of Glyma15g08370

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g08370

Paralog	Evidence	Comments
Glyma13g30990	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g08370 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g077100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g08370

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g08370

Limit To All Plant Sequences

>Glyma15g08370.1   sequence type=CDS   gene model=Glyma15g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCCCAGGGACAAGACTAGTGCCGTTAAGCCTAGCGGTAACGCCGGGGTGAAGGACCTGCATTTTCGTGGAGTCAGGAAGAGACCGTGGGGGAGGTTCGCCGCCGAGATCAGAGATCCCGCCAAGAAGACCCGCGTCTGGCTCGGAACCTTCGACACCGCGGAGGAGGCGGCCCGTGCCTACGACGCCGCCGCGCGGGAGTTTCGCGGCCCTAAGGCGAAGACAAACTTCCCTCTCCCTTCGGAAAATTTTAAGAACGCGAGCCCTAGCCAAAGCAGCACGGTGGAGTCCTCCAGCCGCGACCGCGACGTCGCCGCCGATTCCTCTCCGCTCGACCTCAACCTCGCCCCCGTCGCCGTCTCCTCCGCTCGATTCCCCTTCCGGAACCAGTTCCCGGTTTTCCCCGGCGCGGTGCCGGCGGCGAACCAGGTTATGTACTTCGACGCCGTCCTACGCGCCGGCATGGCCGGTCCACGTGGCTTCGCGTTTGGCTACAATCCTCATCCCGTCGCGGCGAGTGAGTACCACGCGACGACGAGCGACTCGGACTCGTCCTCCGTTATCGATCTGAATCATAACGAAGGCGTTGTTAAGGGGAACGGTTCTAGAATGTTCGATCTCGACCTTAACCATCCTCCTCCACATGAGATCGCTTGA

Predicted protein sequences of Glyma15g08370

Limit To All Plant Sequences

>Glyma15g08370.1   sequence type=predicted peptide   gene model=Glyma15g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPRDKTSAVKPSGNAGVKDLHFRGVRKRPWGRFAAEIRDPAKKTRVWLGTFDTAEEAARAYDAAAREFRGPKAKTNFPLPSENFKNASPSQSSTVESSSRDRDVAADSSPLDLNLAPVAVSSARFPFRNQFPVFPGAVPAANQVMYFDAVLRAGMAGPRGFAFGYNPHPVAASEYHATTSDSDSSSVIDLNHNEGVVKGNGSRMFDLDLNHPPPHEIA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain