SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g06196): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g06196): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g06196

Feature Type:gene_model
Chromosome:Gm15
Start:4386932
stop:4387963
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G64340AT Annotation by Michelle Graham. TAIR10: sequence-specific DNA binding transcription factors;transcription regulators | chr5:25730890-25731936 REVERSE LENGTH=348 SoyBaseE_val: 8.00E-24ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
UniRef100_G7IPM4UniRef Annotation by Michelle Graham. Best UniRef hit: Transcription factor bHLH143 n=2 Tax=Medicago truncatula RepID=G7IPM4_MEDTR SoyBaseE_val: 3.00E-137ISS
UniRef100_G7IPM4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor bHLH143 n=2 Tax=Medicago truncatula RepID=G7IPM4_MEDTR SoyBaseE_val: 3.00E-137ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g06196 not represented in the dataset

Glyma15g06196 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g056600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g06196.1   sequence type=CDS   gene model=Glyma15g06196   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTAAGGATCACAGGTCTTGGCCTTACCCACAGCATGTGGCTTGGCCATCACCTTACTTAAATTGCTCCTGCACCTCGGCAGAGCCCAGTTCGCAGGTTCATTCAGCTTATATGAACCCCAGCACATGCATCTTTCCTGCTGTCAGCGTGTTTCCAGGATTCACAGCTCCTGCTCTCCCAAACTGGAAGACTGAGCAGACCAATGAAGTGCATGGGTTCCATCAGTATCCTCATTCAGAACCATATTTGAAAGAAACACATACTGGAGGGGCTATGCAAAATGCAAATCATGCATCTTTCCAGAAGAAGTTACTTATTTTTGACCACTCTGGTAGTAAGACAAGGATGCTTTATAGTCCTGTCTTCTCTCTTGTCCAAAGTCCAACTGTTACTGCTACAAAATTTGCTCAAGTTTATCATGTAAACATGGAAGCACAGGCAACTAATATGGGCCAAAAGCATTTACCCATATACACTTCACCCGAAGAGACTGGTAAAGATCATATAGACAATGAAGAAAGTGAAATGCATGAAGACACAGAAGAAATCAATGCATTGCTTTATTCTGATGATGATGATGATGATGAGGTAACAAGTACTGGTCATTCTCCATTGGTTACAAAAAGAACTTATGTGATGCAAGAACAGTTTGCAGGCATGAAGAAGGAGGTTGCTGGCTCTGATTGGCCAAACAAAAGGCAGAAGTTAATTGATAGTGGATACAATACACTACCACCACTCATGGACAGTGCTAGTTCCGAAAGGCTAAATGAAATGTGCGAGTATGCCAGTGATGCTGAATCAAAGTATTCTAGTAGTGGCGGGGTGTATGCTGCAAGGCAAACTAAAGAAGATAATCCAACACCTGCTGATATTCAATTGAAAAAGGATAAAATCCGTGAATTGTTGAGAGTTCTCGAGAACTTTATTCCTGGAGCAAAAGGAAAGCATCCCCTGTTAGTCATTGATGGTACTATTGAGTACTTGAAATCTTTGGCGTCCCAAGCTGGTACACTGAAATATCACTAA

>Glyma15g06196.1   sequence type=predicted peptide   gene model=Glyma15g06196   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVKDHRSWPYPQHVAWPSPYLNCSCTSAEPSSQVHSAYMNPSTCIFPAVSVFPGFTAPALPNWKTEQTNEVHGFHQYPHSEPYLKETHTGGAMQNANHASFQKKLLIFDHSGSKTRMLYSPVFSLVQSPTVTATKFAQVYHVNMEAQATNMGQKHLPIYTSPEETGKDHIDNEESEMHEDTEEINALLYSDDDDDDEVTSTGHSPLVTKRTYVMQEQFAGMKKEVAGSDWPNKRQKLIDSGYNTLPPLMDSASSERLNEMCEYASDAESKYSSSGGVYAARQTKEDNPTPADIQLKKDKIRELLRVLENFIPGAKGKHPLLVIDGTIEYLKSLASQAGTLKYH*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo