SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g06030

Feature Type:gene_model
Chromosome:Gm15
Start:4283517
stop:4288327
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g06030
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G65260AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr5:26080501-26082984 REVERSE LENGTH=220 SoyBaseE_val: 1.00E-100ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
KOG4209 KOG Splicing factor RNPS1, SR protein superfamily JGI ISS
PTHR23365Panther POLY-A BINDING PROTEIN 2 JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_C6TN06UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TN06_SOYBN SoyBaseE_val: 8.00E-145ISS
UniRef100_G7JCS4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Polyadenylate-binding protein n=1 Tax=Medicago truncatula RepID=G7JCS4_MEDTR SoyBaseE_val: 7.00E-114ISS

Expression Patterns of Glyma15g06030
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g06030
ParalogEvidenceComments
Glyma08g18970 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g06030 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g054800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g06030
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g06030
>Glyma15g06030.1   sequence type=CDS   gene model=Glyma15g06030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACGACGACGTCGACATGCACGCTGCCGACACCAGCGAAGAATTGGATGACATGAAGAAGCGCTTGAAGGAGATGGAAGATGAAGCTGCTGCTTTGCGAGAGATGCAGGCCAAGGTCGAGAAGGAAATGGGATCTGCGCAAGATCCTGCAAATGCTTCTGCAAGTCAGGCCAATAAAGAGGAAATAGATTCTCGATCAGTCTTTGTAGGCAATGTGGACTATTCATGCACTCCTGAAGAAGTGCAACAGCATTTTCAGTCTTGTGGAACAGTAAACAGAGTCACCATTCGAACTGATAAGTTTGGCCAACCCAAGGGTTATGCCTATGTTGAGTTCCTTGAGGTGGAGGCTGTTCAGGAGGCCCTTTTGCTGAATGAATCTGAACTTCATGGGCGCCAATTAAAGGTAACGGCTAAAAGGACCAACATACCAGGGATGAAACAGTATCGTCCCCGTCGGACCATCAATCCTTACATGGGGGGGTTTCGAGGCAGAACCCCATATGCACCTCCCTTTATCTACTCTCCATATGGATATGGAAAGGTTCCAAGGTTCAGAATGGCAATGCGCTACAGCCCCTACTATTGA
Predicted protein sequences of Glyma15g06030
>Glyma15g06030.1   sequence type=predicted peptide   gene model=Glyma15g06030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENDDVDMHAADTSEELDDMKKRLKEMEDEAAALREMQAKVEKEMGSAQDPANASASQANKEEIDSRSVFVGNVDYSCTPEEVQQHFQSCGTVNRVTIRTDKFGQPKGYAYVEFLEVEAVQEALLLNESELHGRQLKVTAKRTNIPGMKQYRPRRTINPYMGGFRGRTPYAPPFIYSPYGYGKVPRFRMAMRYSPYY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo