Report for Sequence Feature Glyma15g05190
Feature Type: gene_model
Chromosome: Gm15
Start: 3708753
stop: 3710639
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma15g05190
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G09580 AT
Annotation by Michelle Graham. TAIR10: emp24/gp25L/p24 family/GOLD family protein | chr1:3104657-3106092 FORWARD LENGTH=217
SoyBase E_val: 1.00E-91 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0006886 GO-bp
Annotation by Michelle Graham. GO Biological Process: intracellular protein transport
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0016021 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane
SoyBase N/A ISS
GO:0008320 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein transmembrane transporter activity
SoyBase N/A ISS
KOG1691
KOG
emp24/gp25L/p24 family of membrane trafficking proteins
JGI ISS
PTHR22811 Panther
COPII-COATED VESICLE MEMBRANE PROTEIN
JGI ISS
PTHR22811:SF5 Panther
EMP24/GP25L-RELATED
JGI ISS
PF01105 PFAM
emp24/gp25L/p24 family/GOLD
JGI ISS
UniRef100_A2Q3U2 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Emp24/gp25L/p24 n=1 Tax=Medicago truncatula RepID=A2Q3U2_MEDTR
SoyBase E_val: 2.00E-103 ISS
UniRef100_I1MDP2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MDP2_SOYBN
SoyBase E_val: 2.00E-150 ISS
Expression Patterns of Glyma15g05190
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma15g05190
Paralog Evidence Comments
Glyma08g19840 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma15g05190 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.15g046800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma15g05190
Coding sequences of Glyma15g05190
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma15g05190.1 sequence type=CDS gene model=Glyma15g05190 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAGAAGAGAGTTATGTCAATGTCAATTGTCTTCCTCTGCTGCTTGTTCTTGTTCTTCTTCTCAACCTCTGGGGCTCTCTGGGTCACCGTACCACCTTTCAGCACCAAGTGCGTTTCCGAAGAAATCCACAACAACGTCGTCGTTTTGGGCGATTACGCTGTCGTCGACACTGGGAATGATCATTCCAACAACTCCACCATTTCCGTCAAGGTCACATCACCGTACGGAAACAATCTTCATCATATGGAGAACATATCAATTGGTAATTTCGCCTTCACAACTCGAGAGAGTGGAAACTACCTAGCATGCTTCTGGGTGGGTCATAGTGAACGAGCTGGTGGAGACGTTAGTGTGAACCTTGATTGGAAAACTGGAATTGCAGCCAAGGATTGGGATTCAGTTGCTAAAAAAGAAAAGATTGAGGGAGTAGAGCTTCAGTTGAGAAAGCTAGAAGGATCAGTTGAGGCTGTCCACGAGAATTTGATCTATCTGAGGGGCAGGGAAGCAGTGGTAAGGAACGTGAGTGAATCAACCAATGCCAGAGTGGTGTGGTCTAGTTTTATGTCCTTGGGTGTGTGCATTGCAGTTTCAGTTCTGCAGTTGTGGCATTTGAAGCGATACTTCCACAAGAAAAAGCTTATCTAG
Predicted protein sequences of Glyma15g05190
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma15g05190.1 sequence type=predicted peptide gene model=Glyma15g05190 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MEKRVMSMSIVFLCCLFLFFFSTSGALWVTVPPFSTKCVSEEIHNNVVVLGDYAVVDTGNDHSNNSTISVKVTSPYGNNLHHMENISIGNFAFTTRESGNYLACFWVGHSERAGGDVSVNLDWKTGIAAKDWDSVAKKEKIEGVELQLRKLEGSVEAVHENLIYLRGREAVVRNVSESTNARVVWSSFMSLGVCIAVSVLQLWHLKRYFHKKKLI*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
