Glyma15g02850 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g02850

Feature Type:	gene_model
Chromosome:	Gm15
Start:	1992407
stop:	1996225
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g02850

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G13790	AT	Annotation by Michelle Graham. TAIR10: Glycosyl hydrolases family 32 protein \| chr3:4533084-4535831 REVERSE LENGTH=584	SoyBase	E_val: 0	ISS
GO:0002679	GO-bp	Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response	SoyBase	N/A	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0006865	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid transport	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0004553	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds	SoyBase	N/A	ISS
GO:0004564	GO-mf	Annotation by Michelle Graham. GO Molecular Function: beta-fructofuranosidase activity	SoyBase	N/A	ISS
KOG0228	KOG	Beta-fructofuranosidase (invertase)	JGI		ISS
PF00251	PFAM	Glycosyl hydrolases family 32 N-terminal domain	JGI		ISS
PF08244	PFAM	Glycosyl hydrolases family 32 C terminal	JGI		ISS
UniRef100_G7IUH2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Beta-fructofuranosidase, cell wall isozyme n=1 Tax=Medicago truncatula RepID=G7IUH2_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1MCZ9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MCZ9_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma15g02850

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g02850

Paralog	Evidence	Comments
Glyma13g42530	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g02850 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g024600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g02850

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g02850

Limit To All Plant Sequences

>Glyma15g02850.1   sequence type=CDS   gene model=Glyma15g02850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGTATCTCCAATTTTGTTGTTGTTGGCTATCTTCTCTCTCATTTATGGCAATGGTATTCTTCCCATTGAAGCTACCCACCATGTTTACAGAAATCTTCAGACTCTATCTTCTGATTCCTCTGATCAACCTTATAGAACCGCTTACCATTTCCAACCTCCCAAAAATTGGATAAATGACCCTAATGGACCAATGAGGTACAAAGGACTTTATCATCTCTTCTACCAATACAATCCAAAAGGTGCTGTTTGGGGTAATATTGTGTGGGCCCACTCAGTATCAAAGGATCTTGTGAATTGGACCCCTCTAGATCATGCCATCTACCCTTCTCAACCGTCTGATATCAACGGTTGTTGGTCAGGCTCAGCCACAATACTTCCTGGGGGCAAACCAGCCATTTTATACACAGGAATTGACCCTAATAATCACCAAGTTCAAAACTTAGCCCTACCCAAAAACATGTCTGACCCATTACTTAGGGAATGGGTTAAGTCACCCAAAAATCCACTAATGGCACCAACTAGTGCTAACATGATCAATTCAAGCTCATTTAGGGATCCTACCACTGCTTGGCTAGGCAAAGATGGGTACTGGAGGGTGCTGATTGGAAGCAAAATACACACTAGGGGTATGGCAATTTTGTACAAGAGCAAAAACTTTGTTAATTGGGTTCAAGCCAAACAACCCCTACATTCAGCTGAAGGCACTGGAATGTGGGAGTGCCCTGATTTCTATCCAGTGCTGAATAATAAACCATCATCAACTATTGGTCTTGACACATCTGTGAATGGTGATAATGTTAGGCATGTGCTTAAGGTTAGTTTGGATGATAAAAAACATGATCATTATTTGATTGGGACTTATGACATTGCCAAGGATATCTTCACTCCGGATAATGGATTTGAGGATAGTCAAACTGTCCTAAGATATGACTATGGAAAATATTATGCCTCAAAAACCATTTTTGAGGATGGAAAGAACAGAAGGGTCTTATTGGGTTGGGTTAATGAATCCTCAAGTGTTTCGGATGATATCAAGAAAGGATGGGCTGGAATCCATACTATTCCAAGGGCCATCTGGCTTCATAAATCTGGAAAACAGTTGGTGCAATGGCCGGTGGTGGAACTTGAAAGCTTACGTGTGAATCCTGTCCACTGGCCCACCAAAGTGGTCAAAGGTGGTGAAATGCTTCAAGTTACTGGTGTTACTGCGGCACAGGCTGACGTTGAAATTTCATTTGACGTGAATGAGTTTGGAAAGGGCGAAGTATTGGACCAATGGGTGGATCCCCAAATTCTGTGTAGTAGAAAGGGTGCAGCCGTAAAGGGTGGTTTGGGACCCTTTGGCTTGCTAGTTTTTGCTTCTCGTGGCTTGCAAGAGTACACGGCAGTATTCTTTAGAATATTCAGATACCAAAATAAAAATTTGGTTCTCATGTGTAGCGACCAAAGCAGATCCTCTTTGAATAAAGATAACGATATGACCACCTATGGGACTTTTGTGGACATGGACCCTCTTCATGAGAAGCTGTCACTAAGAACTTTGATTGATCACTCAGTAGTGGAGAGTTTTGGAGGAGAGGGAAGGGCTTGCATCACAGCCAGAGTATATCCCACAATAGCAATTAATGAAAAGGCACAACTATATGCTTTCAATAATGGAACTGCCGCCGTCAAGATTACAAGATTGAGTGCTTGGAGCATGGAGAAGGCAAAAATAAACTGA

Predicted protein sequences of Glyma15g02850

Limit To All Plant Sequences

>Glyma15g02850.1   sequence type=predicted peptide   gene model=Glyma15g02850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVSPILLLLAIFSLIYGNGILPIEATHHVYRNLQTLSSDSSDQPYRTAYHFQPPKNWINDPNGPMRYKGLYHLFYQYNPKGAVWGNIVWAHSVSKDLVNWTPLDHAIYPSQPSDINGCWSGSATILPGGKPAILYTGIDPNNHQVQNLALPKNMSDPLLREWVKSPKNPLMAPTSANMINSSSFRDPTTAWLGKDGYWRVLIGSKIHTRGMAILYKSKNFVNWVQAKQPLHSAEGTGMWECPDFYPVLNNKPSSTIGLDTSVNGDNVRHVLKVSLDDKKHDHYLIGTYDIAKDIFTPDNGFEDSQTVLRYDYGKYYASKTIFEDGKNRRVLLGWVNESSSVSDDIKKGWAGIHTIPRAIWLHKSGKQLVQWPVVELESLRVNPVHWPTKVVKGGEMLQVTGVTAAQADVEISFDVNEFGKGEVLDQWVDPQILCSRKGAAVKGGLGPFGLLVFASRGLQEYTAVFFRIFRYQNKNLVLMCSDQSRSSLNKDNDMTTYGTFVDMDPLHEKLSLRTLIDHSVVESFGGEGRACITARVYPTIAINEKAQLYAFNNGTAAVKITRLSAWSMEKAKIN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain