Report for Sequence Feature Glyma15g02053
Feature Type: gene_model
Chromosome: Gm15
Start: 1374688
stop: 1377689
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma15g02053
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G50390 AT
Annotation by Michelle Graham. TAIR10: Transducin/WD40 repeat-like superfamily protein | chr3:18702137-18703546 FORWARD LENGTH=469
SoyBase E_val: 4.00E-30 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005834 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: heterotrimeric G-protein complex
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
PTHR22844 Panther
F-BOX AND WD40 DOMAIN PROTEIN
JGI ISS
PF00400 PFAM
WD domain, G-beta repeat
JGI ISS
UniRef100_G7IUN3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: WD repeat-containing protein n=1 Tax=Medicago truncatula RepID=G7IUN3_MEDTR
SoyBase E_val: 1.00E-125 ISS
UniRef100_UPI000233AD32 UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233AD32 related cluster n=1 Tax=unknown RepID=UPI000233AD32
SoyBase E_val: 9.00E-176 ISS
Expression Patterns of Glyma15g02053
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma15g02053
Paralog Evidence Comments
Glyma13g43290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma15g02053 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.15g017700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma15g02053
Coding sequences of Glyma15g02053
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma15g02053.1 sequence type=CDS gene model=Glyma15g02053 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGACGACTCCAACTCACCTGATCCCACCGCATCCTTTGCTTTTAGATCCACAACCACAACCACAACACCTCAGAGCAACTTCTTGAGAAGCCATTCTACTAAAGAAACCCCTTTCTCAAACTTCATTCACTCCCCACCACGCCTCTCTTGTCCCACTCTTTCTCGTAGCCTCCAAAACTCTCCTATTTCCTCTCCACTTCACCACCGTCAATTCTCACCCCCTCCCTCTCCTCCTTCTCCCACAAAACTCTCTGATTCTGAACCTCAAACCACTTACCACTGTGCCTCTTCAGTCCTCAGAAACGATGGACAGATCCTCTCCATTGCCCTGTCATCAAATGGTTTGGTCTACACTGGCTCTGACTCAAACCTTGTGAGGGTGTGGAAGCTCCCTGAGTTCACCGAATGTGGACAACTCAGGACCAAGGCTTGCAGGGTGGTGGCCCTCGAAGTGTCCAATGACACGGTTTATGCAGCATATGGTGATGGCAAAATAAGGGTATGGAGAAGAACTTGGGATAAGGTGTTGAAGCATGTTCGGTTGGCTACCATCCCAAAGACACTCGGCTATGTTCGCAGCTACATCGCCGGCAAAGACAAGACAATGCACAAGGGGCTAATCACGGCAATGGCAATAAACACAGCAGAGGACATTCTATACACAGCTTCCCTGGACAAAACGGTGAAAGTGTGGAGAATCTCAGACCTGAAGTGCATAGAGACCATCAAGGCACACACTGAGCCAATCAACGCCATCATAGTGGCAGATGATGGAGTCCTCTAA
Predicted protein sequences of Glyma15g02053
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma15g02053.1 sequence type=predicted peptide gene model=Glyma15g02053 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MDDSNSPDPTASFAFRSTTTTTTPQSNFLRSHSTKETPFSNFIHSPPRLSCPTLSRSLQNSPISSPLHHRQFSPPPSPPSPTKLSDSEPQTTYHCASSVLRNDGQILSIALSSNGLVYTGSDSNLVRVWKLPEFTECGQLRTKACRVVALEVSNDTVYAAYGDGKIRVWRRTWDKVLKHVRLATIPKTLGYVRSYIAGKDKTMHKGLITAMAINTAEDILYTASLDKTVKVWRISDLKCIETIKAHTEPINAIIVADDGVL*