SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g00690

Feature Type:gene_model
Chromosome:Gm15
Start:400846
stop:402852
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g00690
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G20320AT Annotation by Michelle Graham. TAIR10: dicer-like 4 | chr5:6859571-6869068 REVERSE LENGTH=1702 SoyBaseE_val: 1.00E-21ISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006353GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, termination SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010216GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of DNA methylation SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0010599GO-bp Annotation by Michelle Graham. GO Biological Process: production of lsiRNA involved in RNA interference SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016569GO-bp Annotation by Michelle Graham. GO Biological Process: covalent chromatin modification SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0030422GO-bp Annotation by Michelle Graham. GO Biological Process: production of siRNA involved in RNA interference SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0003725GO-mf Annotation by Michelle Graham. GO Molecular Function: double-stranded RNA binding SoyBaseN/AISS
GO:0004386GO-mf Annotation by Michelle Graham. GO Molecular Function: helicase activity SoyBaseN/AISS
GO:0004525GO-mf Annotation by Michelle Graham. GO Molecular Function: ribonuclease III activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008026GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent helicase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0016891GO-mf Annotation by Michelle Graham. GO Molecular Function: endoribonuclease activity, producing 5'-phosphomonoesters SoyBaseN/AISS
PTHR10910Panther EUKARYOTE SPECIFIC DSRNA BINDING PROTEIN JGI ISS
PTHR10910:SF57Panther JGI ISS
PF00035PFAM Double-stranded RNA binding motif JGI ISS
UniRef100_B9SMV4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Double-stranded RNA binding protein, putative n=1 Tax=Ricinus communis RepID=B9SMV4_RICCO SoyBaseE_val: 2.00E-32ISS
UniRef100_I1MCB9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MCB9_SOYBN SoyBaseE_val: 2.00E-142ISS

Expression Patterns of Glyma15g00690
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma15g00690 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g004500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g00690
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g00690
>Glyma15g00690.1   sequence type=CDS   gene model=Glyma15g00690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACAATTTCTCCCACGCGCCCAATTTTGCTGTTAATCTCAATCACCTTCCTCCAATCAACCCCTTTCGAATCACCAACTCTAAGGGTCAAATGAACAATTCTTGTAGCAGAGCTGCTGCTAAAGCTGTGAAGCGAAACCCCAACCAGAGAATGAAGTTCGTTGCTTCTGATAAAGACATTGTCAAAAATCCCTCCTTGGGAATGGGAAACATTGTCGTTGAAGACACATCTTCAACTTCATCTAACCAAAAGATTCAGTCTTGTGGCAACACAACCTCCCCAACTCAGACAGAAGAAGGTATGAAGAAAGGAACTGCTAGGTCTACTTTGTACGAGATCTGTGCTGTGAACTGTTGGAAACCCCCAATATTTGAATGTTGCAAAGAGGAAGGCCCAGGTCATAAGAGAATGTTCACCTTCAAGGTTATTATAGAGATAGAAGCATCGAGAAACATAATAGAGTGCTACGGTGCCCCTCATGGAAAAAAGAAAGCAGCAGCAGACCATGCAGCTGAGGGAGCATTATTGTACCTAAAAGTATACAAGATGTATGATGAAAAACCAATAAATAAAAAGTAG
Predicted protein sequences of Glyma15g00690
>Glyma15g00690.1   sequence type=predicted peptide   gene model=Glyma15g00690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENNFSHAPNFAVNLNHLPPINPFRITNSKGQMNNSCSRAAAKAVKRNPNQRMKFVASDKDIVKNPSLGMGNIVVEDTSSTSSNQKIQSCGNTTSPTQTEEGMKKGTARSTLYEICAVNCWKPPIFECCKEEGPGHKRMFTFKVIIEIEASRNIIECYGAPHGKKKAAADHAAEGALLYLKVYKMYDEKPINKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo