Report for Sequence Feature Glyma15g00590
Feature Type: gene_model
Chromosome: Gm15
Start: 323557
stop: 330935
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma15g00590
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G15960 AT
Annotation by Michelle Graham. TAIR10: NRAMP metal ion transporter 6 | chr1:5482202-5485066 REVERSE LENGTH=527
SoyBase E_val: 0 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0006828 GO-bp
Annotation by Michelle Graham. GO Biological Process: manganese ion transport
SoyBase N/A ISS
GO:0006875 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular metal ion homeostasis
SoyBase N/A ISS
GO:0015691 GO-bp
Annotation by Michelle Graham. GO Biological Process: cadmium ion transport
SoyBase N/A ISS
GO:0030001 GO-bp
Annotation by Michelle Graham. GO Biological Process: metal ion transport
SoyBase N/A ISS
GO:0070574 GO-bp
Annotation by Michelle Graham. GO Biological Process: cadmium ion transmembrane transport
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0005215 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transporter activity
SoyBase N/A ISS
GO:0015086 GO-mf
Annotation by Michelle Graham. GO Molecular Function: cadmium ion transmembrane transporter activity
SoyBase N/A ISS
GO:0015103 GO-mf
Annotation by Michelle Graham. GO Molecular Function: inorganic anion transmembrane transporter activity
SoyBase N/A ISS
GO:0046873 GO-mf
Annotation by Michelle Graham. GO Molecular Function: metal ion transmembrane transporter activity
SoyBase N/A ISS
KOG1291
KOG
Mn2+ and Fe2+ transporters of the NRAMP family
JGI ISS
PTHR11706 Panther
MANGANESE TRANSPORTER
JGI ISS
PTHR11706:SF10 Panther
METAL TRANSPORTER NRAMP (NRAMP)
JGI ISS
PF01566 PFAM
Natural resistance-associated macrophage protein
JGI ISS
UniRef100_B9N9Y7 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Nramp transporter n=1 Tax=Populus trichocarpa RepID=B9N9Y7_POPTR
SoyBase E_val: 0 ISS
UniRef100_I1MCB0 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MCB0_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma15g00590
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma15g00590
Paralog Evidence Comments
Glyma13g44710 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma15g00590 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.15g003500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma15g00590
Coding sequences of Glyma15g00590
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma15g00590.1 sequence type=CDS gene model=Glyma15g00590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTTTCACAGGTTCTGGTTCCGGGCAGCCACAATTCATTTCCAGCACTGGCAACCGAAGCTTTTCCAATGCGCCACTCATTGAGAACTCCGATACTAATCAAATTGTTGTGCCTGATAGGAGAAGCTGGAAAAATTTATTTGCATACATGGGGCCTGGGTTTCTTGTTTCCATTGCATATATAGATCCAGGAAACTTCGAGACGGATCTTCAGTCTGGGGCACAATATAAATATGAGTTACTTTGGATCATATTGTTGGCATCATGTGCTGCTCTTGTAATTCAATCAATGGCAGCCAATCTTGGGGTGGTCACTGGAAAACACTTAGCAGAGCACTGTAGATCTGAATATCCCCGGGTGCCCAACTTCATACTTTGGATTATTGCTGAAATTGCCATAGTGGCTTGTGACATTCCTGAAGTAATTGGGACAGCCTTTGCATTGAACATGCTCTTCAACATACCTGTTTGGATTGGTGTTCTTCTGACAGGACTCAGCACATTGATCCTCTTAGCATTACAGCAATATGGGGTTAGGAAACTTGAATTCTTGATTGCATTTCTAGTATTTACAATTGCTGCATGTTTTATGGTTGAGCTTGGATATGCAAAGCCTGATGCTAAAGAAGTTCTGAAGGGTCTTTTTGTGCCAGGACTAAAAGGGAGTGGTGCTACTGGTCTTGCAATTTCTCTTCTTGGAGCTATGGTTATGCCGCACAATCTCTTCTTGCACTCAGCACTGGTGCTCTCTAGGAAAATACCACGATCAGTTCTGGGAATTAGGGAGGCTTGCAGGTTTTACATGATAGAAAGTGCTTTTGCTCTCATGGTGGCCTTCCTCATAAACATCTGCGTTATTTCTGTAAGTGGCACTGTTTGCAATTCTTCAAATTTGAATGCTGAAGATCAACTGAGCTGTCAGGATTTGGATCTGAACAAAGCCTCCTTCCTACTCAGAAATGTCTTGGGGAAATGGAGCTCAAAACTATTTGGAATTGCTTTGCTTGCATCGGGTCAAAGTTCTACTATTACAGGAACCTACGCAGGACAGTATGTCATGCAGGGATTTCTGGATTTACGACTGGAGCCATGGATTCGGAATATGTTAACTCGTTGCTTAGCCATAGTTCCTAGTTTGATTGTTGCAGTCATTGGTGGCTCTGCTGGGGCTGGGAAGCTCATAATAATTGCATCTATGATCTTATCATTTGAGCTTCCTTTTGCTTTGGTTCCACTCCTCAAGTTTACAAGCAGCAAAACCAAGATGGGGACACATGTCAACTCTACCATGATTTCGGCTGTTACTTGGATAATCGGTACCCTCCTCATGGCCATTAATATATACTACTTAATAACTGGCTTCATCAAGCTGCTGCTTCATAGTCACTTAAAAATTGTGGCTAAGGTGTTTCTTGGGATACTAGGATTTTCAGGCATGGCAATGTATTTGGCTGGTACAACATATCTAGTACTTCGCAAAAACAAAGAGGCTACACACCTTTTGGCTCTAACAGCACCAGAAAATCAACAAATGACAAATGAACTAGGCAATGGTTCAATCTATTCTCTTCCAAGAGAAGACATAGTAAGCATGCAATTGCCTCAAAGAAGTACTCCTGCTCCTGCAGATGTTGACTGA
Predicted protein sequences of Glyma15g00590
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma15g00590.1 sequence type=predicted peptide gene model=Glyma15g00590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAFTGSGSGQPQFISSTGNRSFSNAPLIENSDTNQIVVPDRRSWKNLFAYMGPGFLVSIAYIDPGNFETDLQSGAQYKYELLWIILLASCAALVIQSMAANLGVVTGKHLAEHCRSEYPRVPNFILWIIAEIAIVACDIPEVIGTAFALNMLFNIPVWIGVLLTGLSTLILLALQQYGVRKLEFLIAFLVFTIAACFMVELGYAKPDAKEVLKGLFVPGLKGSGATGLAISLLGAMVMPHNLFLHSALVLSRKIPRSVLGIREACRFYMIESAFALMVAFLINICVISVSGTVCNSSNLNAEDQLSCQDLDLNKASFLLRNVLGKWSSKLFGIALLASGQSSTITGTYAGQYVMQGFLDLRLEPWIRNMLTRCLAIVPSLIVAVIGGSAGAGKLIIIASMILSFELPFALVPLLKFTSSKTKMGTHVNSTMISAVTWIIGTLLMAINIYYLITGFIKLLLHSHLKIVAKVFLGILGFSGMAMYLAGTTYLVLRKNKEATHLLALTAPENQQMTNELGNGSIYSLPREDIVSMQLPQRSTPAPADVD*