Glyma14g38871 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma14g38871): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma14g38871): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma14g38871

Feature Type:	gene_model
Chromosome:	Gm14
Start:	48052514
stop:	48054230
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma14g38871

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G46940	AT	Annotation by Michelle Graham. TAIR10: DUTP-PYROPHOSPHATASE-LIKE 1 \| chr3:17288367-17288867 REVERSE LENGTH=166	SoyBase	E_val: 2.00E-86	ISS
GO:0006261	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication	SoyBase	N/A	ISS
GO:0006281	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA repair	SoyBase	N/A	ISS
GO:0009394	GO-bp	Annotation by Michelle Graham. GO Biological Process: 2'-deoxyribonucleotide metabolic process	SoyBase	N/A	ISS
GO:0046080	GO-bp	Annotation by Michelle Graham. GO Biological Process: dUTP metabolic process	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0000287	GO-mf	Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding	SoyBase	N/A	ISS
GO:0004170	GO-mf	Annotation by Michelle Graham. GO Molecular Function: dUTP diphosphatase activity	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
GO:0042802	GO-mf	Annotation by Michelle Graham. GO Molecular Function: identical protein binding	SoyBase	N/A	ISS
KOG3370	KOG	dUTPase	JGI		ISS
PTHR11241	Panther	DEOXYURIDINE 5'-TRIPHOSPHATE NUCLEOTIDOHYDROLASE	JGI		ISS
PF00692	PFAM	dUTPase	JGI		ISS
UniRef100_Q9STG6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Deoxyuridine 5'-triphosphate nucleotidohydrolase n=2 Tax=Arabidopsis thaliana RepID=DUT_ARATH	SoyBase	E_val: 7.00E-84	ISS
UniRef100_UPI000233B588	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233B588 related cluster n=1 Tax=unknown RepID=UPI000233B588	SoyBase	E_val: 3.00E-121	ISS

Expression Patterns of Glyma14g38871

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma14g38871 not represented in the dataset	Glyma14g38871 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma14g38871 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.14g207800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma14g38871

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma14g38871

Limit To All Plant Sequences

>Glyma14g38871.1   sequence type=CDS   gene model=Glyma14g38871   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGGAAAATTCAGTGCCATGAGAACATTTCGCGCCATTTCTCTTCCTCTTCCTCTATATAAACCCTACCCTCACCTTCAATTTCCATTTCTCTCGTCAAATTTATCCATTCACCACAGAGTTTCTTCAATGGCCCAGCCTCAACCAGAGTCCCACGCCACCAATGGCTCACACGAGCCATTGCTCAAAATCCCAAAGCTCCACCAAAACGGCGACGTTTCCGCAACCGCTCCCTTTCTCCGCGTCAAGAAGCTCTCCGACAAGGCCGTTTTGCCCTCTAGGGCTTCCCCTCTCTCCGCCGGTTACGATCTCTCTAGCGCGGTGGAGACGAAGGTCCCGGCGAGAGGGAAGGCTCTGGTGGCCACTGACATCAGCATCGCGATTCCAGAGGGCACATATGCTCGCGTTGCGCCGCGTTCGGGGTTGGCGTGGAAGCACTCGATCGACGTGGGTGCGGGGGTGATAGATGCGGATTACAGGGGTCCGGTTGGGGTTATACTTTTCAACCATTCGGACACGGATTTTGAGGTGAAGGTTGGGGACAGGGTTGCGCAACTTATCATTGAGAAGATTGTGACACCGAATGTTGTTACAGAGGTCGAGGATTTGGATGAGACTGTTAGAGGTGAAGGTGGGTTTGGATCCACCGGTGTTTGA

Predicted protein sequences of Glyma14g38871

Limit To All Plant Sequences

>Glyma14g38871.1   sequence type=predicted peptide   gene model=Glyma14g38871   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGKFSAMRTFRAISLPLPLYKPYPHLQFPFLSSNLSIHHRVSSMAQPQPESHATNGSHEPLLKIPKLHQNGDVSATAPFLRVKKLSDKAVLPSRASPLSAGYDLSSAVETKVPARGKALVATDISIAIPEGTYARVAPRSGLAWKHSIDVGAGVIDADYRGPVGVILFNHSDTDFEVKVGDRVAQLIIEKIVTPNVVTEVEDLDETVRGEGGFGSTGV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain